1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
77julia77 [94]
2 years ago
9

Which process begins the formation of sedimentary rock? the movement of sediment the cementation of rock sediment the breakdown

of rock into sediment the buildup of sediment in one location
I will mark Brainlyest and 100 points
Chemistry
1 answer:
max2010maxim [7]2 years ago
5 0

Answer:

C- the breakdown of rock into sediment

Explanation:

Because sedimentary rocks have layers and are made of of those layers which are made up of the breakdown of rock into sediment.

hope this helps:)

You might be interested in
What are Properties that can be recognized only when substances react or do not react
sergiy2304 [10]

Answer:

Chemical properties can be recognized only when substances react or do not react chemically with one another, that is, when they undergo a change in composition. A chemical property of one substance usually involves its ability to react or not react with another specific substance.

4 0
2 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
What 2 solutions could help restore the ecosystem back to normal?
Pavel [41]
  • Renewable energy and energetic efficiency. ...
  • The electric vehicle. ...
  • Greater environmental control. ...
  • Air purifiers. ...
  • Graphene filter for water. ...
  • Food sovereignty and agroecology. ...
  • Sustainable development.
6 0
2 years ago
What is the concentration of NaCl in a solution if titration of 15.00 mL of the solution with 0.2503 M AgNO3 requires 20.22 mL o
Nina [5.8K]

Answer:

The concentration of NaCl = 0.3374 M

Explanation:

Given :

Molarity of AgNO₃ = 0.2503 M

Volume of AgNO₃ = 20.22 mL

The conversion of mL into L is shown below:

1 mL= 10^{-3} L

Thus, volume of the solution = 20.22×10⁻³ L

Molarity of a solution is the number of moles of solute present in 1 L of the solution.

Molarity=\frac{Moles\ of\ solute}{Volume\ of\ the\ solution}

The formula can be written for the calculation of moles as:

Molarity=\frac{Moles\ of\ solute}{Volume\ of\ the\ solution}

Thus,  

Moles\ of\ AgNO_3 =Molarity \times {Volume\ of\ the\ solution}

Moles\ of\ AgNO_3 =0.2503 \times {20.22\times 10^{-3}}\ moles

Moles\ of\ AgNO_3 = 5.0611 \times 10^{-3} moles

The chemical reaction taking place:

AgNO_3_(aq) + NaCl_(aq) \rightarrow AgCl_(s) + NaNO_3_(aq)

According to reaction stoichiometry:

<u>1 mole</u> of AgNO₃ reacts with <u>1 mole</u> of NaCl

Thus,

5.0611×10⁻³ moles of AgNO₃ reacts with 5.0611×10⁻³ moles of NaCl

Thus, moles of NaCl required = 5.0611×10⁻³ moles

Volume of NaCl required = 15.00 mL

The conversion of mL into L is shown below:

1 mL= 10^{-3} L

Thus, volume of the solution = 15.00×10⁻³ L

Applying in the formula of molarity as:

Molarity=\frac{Moles\ of\ solute}{Volume\ of\ the\ solution}

Molarity\ of\ NaCl=\frac{5.0611\times 10^{-3}}{15.00\times 10^{-3}}

Molarity\ of\ NaCl= 0.3374 M

<u>Thus, the concentration of NaCl = 0.3374 M</u>

6 0
3 years ago
There are two open cans of soda on the table. One can was just taken from the refrigerator and the other was taken from the cupb
nika2105 [10]
I think the correct answer from the choices listed above is option C. The can <span>from the cupboard will lose carbon dioxide more quickly because it is warmer and gases are less soluble in warmer temperatures. </span> Solubility of gases is a strong function of temperature and as well as pressure.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Describe one conclusion made by Thomson that led to the development of the current atomic theory
    7·1 answer
  • How much heat energy is required to raise the temperature of 200 grams of water from 25 degrees to 100 degrees?
    13·1 answer
  • How can I separate gasoline and vegetable oil?
    13·1 answer
  • The table below shows the chemical symbols for some common elements. Based on the information in the table, which of the four su
    9·1 answer
  • Dominic made the table below to organize his notes about mixtures,
    12·1 answer
  • A student found the mass of an object to be 26.5 g. To find the volume, the student submerged the object in a graduated cylinder
    11·1 answer
  • At 1.0atm a gas has a volume of 36.7 L, what is the volume at 5.3atm?
    6·1 answer
  • Which of these statements is correct with respect to pH?
    13·2 answers
  • 1 point
    5·1 answer
  • A 25 mL syringe is used to measure both 10mL of a solution and 20mL of a solution. Which measurement, if any, has the biggest pe
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!