1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlabodo [156]
2 years ago
11

A gas has a volume of 1000.0 mL at a temperature of 20.OK and a pressure

Chemistry
1 answer:
yanalaym [24]2 years ago
4 0

Answer:

4000mL

Explanation:

Using the combined gas law equation as follows:

P1V1/T1 = P2V2/T2

Where;

P1 = initial pressure (atm)

P2 = final pressure (atm)

V1 = initial volume (mL)

V2 = final volume (mL)

T1 = initial temperature (K)

T2 = final temperature (K)

According to the information given in this question:

V1 = 1000mL

T1 = 20K

P1 = 1.0atm

V2 = ?

P2 = 0.5atm

T2 = 40K

Using P1V1/T1 = P2V2/T2

1 × 1000/20 = 0.5 × V2/40

1000/20 = 0.5V2/40

50 = 0.5V2/40

50 × 40 = 0.5V2

2000 = 0.5V2

V2 = 2000/0.5

V2 = 4000mL

You might be interested in
Pls helps asap plsssssss
Lisa [10]

Answer:

A spectator ion refers to a charged atom in a chemical reaction that does not undergo a chemical change.

Hope this helps!!!

4 0
2 years ago
Read 2 more answers
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
2 years ago
How many molecules are in 2.0 moles of carbon dioxide?
zubka84 [21]

Answer:

There are 1.51 x 1024 molecules of carbon dioxide in 2.50 moles of carbon dioxide.

Explanation:

7 0
3 years ago
How does heat conduction work in the metal brownie pan?
34kurt
The metal conducts the heat and through conduction, cooks the brownies; conduction also cooks the brownies in the glass pan, but since infrared goes right through the glass, they also cook by radiation.
7 0
3 years ago
Which of the following is a physical property of a substance?
vaieri [72.5K]
B boiling point https://chem.libretexts.org/Bookshelves/Introductory_Chemistry/Map%3A_Introductory_Chemistry_(Tro)/03%3A_Matter_and_Energy/3.05%3A_Differences_in_Matter%3A_Physical_and_Chemical_Properties#Summary
8 0
3 years ago
Other questions:
  • What do scientists use to determine what the interior of a moon is like?
    14·1 answer
  • A Continental rift is also called a
    13·1 answer
  • Identify whether each species functions as a Brønsted-Lowry acid or a Brønsted-Lowry base in this net ionic equation.CH3COO-+HCO
    7·1 answer
  • Bilang mga dalaga at binata, paano nyo lilinangin ang mga aspeto ng tao na inyong taglay?​
    15·2 answers
  • Which describes an object in projectile motion? Check all that apply.
    10·2 answers
  • Which of the following best describes a chemical mixture​
    12·1 answer
  • Calcium reacts with hydrochloric acid,HCI, to make calcium chloride and hydrogen gas (H2).
    15·1 answer
  • How many atoms are in a molecule of RSq?
    15·1 answer
  • A gas expands from 2.5 L to 8.6 L at a constant temperature. If the initial pressure is 1.6 atm, what is the final pressure?
    9·1 answer
  • If there is sufficient water in the reaction system, how many grams of KOH can be produced from 22.2 g of K?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!