1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmasim [6.3K]
3 years ago
5

Select whether the statement is for Speed, Velocity, or Acceleration.

Chemistry
1 answer:
Vesna [10]3 years ago
4 0

Answer:

I think that the statement is relative to speed because it is saying km per second.

You might be interested in
Need help setting the problem up
Sveta_85 [38]

Answer:

4.0 moles

Explanation:

The following data were obtained from the question:

Volume (V) = 12L

Pressure = 5.6 atm

Temperature (T) = 205K

Gas constant (R) = 0.08206 atm.L/Kmol

Number of mole (n) =?

Using the ideal gas equation: PV = nRT, the number of mole of the gas can be obtained as follow

PV = nRT

5.6 x 12 = n x 0.08206 x 205

Divide both side by 0.08206 x 205

n = (5.6 x 12)/(0.08206 x 205)

n = 4.0 moles

Therefore, the number of mole of the gas is 4.0 moles

5 0
3 years ago
The formula for water is H20. What does the formula H2O tell us about the composition<br> of water?
Llana [10]
H2O is the chemical formula of water. It means that each molecule of water is made up of two hydrogen atoms, indicated by the letter H, and a single oxygen atom, represented by the O. Water is a chemical substance with no smell, taste, or color.
4 0
2 years ago
How many moles of mg3n2 would be produced when 180.0 g of mg reacts with 85.0 g of n2?
aalyn [17]
2.47 moles are produce if 85g of N2 react with 180g of Mg
7 0
3 years ago
What happens when an electrolyte, NaCl is added to hydrate ferric oxide solution​
Dafna11 [192]

Answer:

hydrated ferric oxide is ferric hydoxide sol and is positively charged. When aqueous solution of NaCl is added to it,the Cl- ions neutralise the positive charge on the sol particles. In the absence of charge, brown precipitate is formes due to colloids can be coagulation of particles.Nov 11, 2020

Explanation: hope this help

4 0
3 years ago
Classify each of the following bonds as non polar covalent polar or ionic
Soloha48 [4]
A) Polar (Cl is more electronegative than Si)
b) Nonpolar (Both atoms have the same electronegativity)
c) Ionic (Ionic bonds happen between a metal and a nonmetal)
d) Nonpolar (Hydrogen and carbon have about the same electronegativity) this is a common nonpolar bond)
You can identify the type of bon by looking at what is being bonded (nonmetal or metal) and the placement of the elements on the periodic table (electronegativity increases going up a group and going from left-right across a period).
3 0
3 years ago
Other questions:
  • 3) Of the choices below, which of the following contains covalent bonds? A. PCl5 B. RbCl C. PbCl2 D. MoCl6
    8·1 answer
  • Match the following aqueous solutions with the appropriate letter from the column on the right.1. 0.19 m AgNO3 2. 0.17 m CrSO4 3
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • How many seconds does it take to deposit 0.94 g of Ni on a decorative drawer handle when 14.9 A is passed through a Ni(NO3)2 sol
    10·1 answer
  • How does the diaphragm aide in breathing?
    9·2 answers
  • 11. Selecting specific traits to create a new breed of an animal would be an
    5·1 answer
  • How do gamma rays differ from a microwave
    10·1 answer
  • What are weather balloons? (3 points)
    11·2 answers
  • What is the pH value of lithium chloride?
    9·1 answer
  • A force that exists throughout the universe. Earth's will pull on you at a rate of 9.8 m/s2 if you ignore friction.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!