1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
coldgirl [10]
3 years ago
13

Write the formula for each compound

Chemistry
1 answer:
nalin [4]3 years ago
5 0

Answer:

Chromium(III) Sulfite Cr2(SO3)3 Molecular Weight

Mg(ClO)2 - PubChem

Ni(NO3)2

You might be interested in
When Kristen was five, she became sick with chickenpox and then recovered. What claim explains why Kristen is unlikely to get ch
VLD [36.1K]

Answer:

the answer is A!

Mark as brainless

5 0
3 years ago
Read 2 more answers
Which is transferred due to a temperature difference?
Sliva [168]

Answer:

A

Explanation:

heat energy is transfered through a hot object touching a cold object

5 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
Earth Science 10/ Chemistry 11
timama [110]

Measuring the ratio of C-14 to C-12 in the remains of dead organisms to determine how much time has passed since the organism died

the answer is D

6 0
3 years ago
Calculate the vapor pressure of a solution made by dissolving 11.1 g Ca(OH)2 in 1 102 g of water at 25 °C. Vapor pressure of pur
Levart [38]

Answer:

23.15 mmHg.

Explanation:

To solve this question you need to understand that part of Raoult's law in your Chemistry textbook. So, let us delve right into the solution of the question.

We are given parameters such as the mass of Ca(OH)2 to be = 11.1 grams, mass of solvent = 102 grams, the Vapor pressure of pure water= 23.76 mm Hg, temperature = 25°C and vapour pressure of the solution= ??.

The molar mass of Ca(OH)2= 74 g/mol.

The first thing to do is to find the number of moles of Ca(OH)2 and that of water from the formula below;

Mass/ molar mass = Number of moles.

===> Number of moles, n= 11.1/ 74.

Number of moles = 0.15 moles Ca(OH)2.

===> Number of moles, n= 102/ 18.

Number of moles, n= 5.67 moles of water.

Next, we add the two moles together to find the solvent mile fraction since vapour pressure is proportional to mole fraction.

Then;

0.15 + 5.67 = 5.82.

Therefore, 5.67/ 5.82= 0.97.

Hence the vapor pressure of a solution = 0.97 × 23.76.

vapor pressure of a solution = 23.15 mmHg.

4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the maximum number of electrons in the following energy leve? n-3<br><br>2<br>32<br>8<br>18​
    8·1 answer
  • Which of the following statements is true?
    10·1 answer
  • 2. Atoms are stable and not likely to react when.
    8·1 answer
  • what happens when an object speeds up,slows down, or changes direction A) velocity B) time C) deceleration D) acceleration
    9·2 answers
  • Which chemical equation describes an acid-base neutralization reaction?
    6·1 answer
  • What is rate a of reaction
    10·1 answer
  • Dylan has a coworker who is always showing up late and then not finishing his work on time . It's frustrating the other members
    7·1 answer
  • Potassium is an alkali metal that is one of the electrolytes needed by the human body to conduct nerve impulses. The majority of
    8·1 answer
  • How may moles are in 88.4 grams of Al(OH)3?
    8·1 answer
  • What is the Anion and it’s charge.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!