1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alchen [17]
3 years ago
11

Look at the picture and solve

Chemistry
1 answer:
romanna [79]3 years ago
4 0
<h2>Answer:</h2>

[4] - 3/2 - 7/4 => - 6 - 7 /4 => - 13/4 => - 3¼.

<u>Correct choice</u> - ✔ [C] - 3¼.

[6] (a) - 729 = - 9³.

(e) 216 = 6³.

You might be interested in
Key terms: Reset Compounds that contain a carbon-carbon double bond are known as ____________ . Alkenes are electron rich; there
Damm [24]

Answer: Compounds that contain a carbon-carbon double bond are known as _____alkenes_______ . Alkenes are electron rich; therefore, simple alkenes do not react with _____nuceophiles_______ or bases, but will react with _____electrophiles_______ or acids. In the IUPAC system, an alkene is identified by the suffix _____-ene_______ . Addition reactions in which two parts of a reagent are added to the same side of a double bond are known as _____syn_______ additions. Addition reactions in which two parts of a reagent are added from opposite sides of a double bond are called _____anti_______ additions. Halogenation and halohydrin formation occur with _____anti_______ addition. Hydroboration occurs with _____syn_______ addition.

Explanation:

The right terms have been filled into the statement.

Electrophiles are election rich so they react with nucleophiles. And vice versa.

Addition reactions in which two parts of a reagent are added to the same side of a double bond are known as _syn reaction and that involving opposite is anti reaction.

The Halohydrin formation reaction involves breaking a pi bond and creating a halohydrin in its place. Halo = halogen and Hydrin = OH. This reaction takes place in water and yields an anti-addition reaction which follows Markovnikov's rule.

8 0
3 years ago
Calculate the number of moles in 7g of nitrogen gas​
Andru [333]

Answer:

<h3>0.2498molN_{2}</h3>

Explanation:

7gN2 x \frac{1 mol}{2(14.01) g}

=0.2498mol N2

Nitrogen gas has the formula N_{2} so therefore that means you would have to multiply the mass in the molar by 2. To solve for the number of moles you need to cancel out the grams, you do this by using the molar mass of nitrgoen gas. You get the value on in the denominator from the periodic table (atomic mass of element). The grams will cancel out, leaving you with the number of moles when you divide 7/2(14.01).

5 0
3 years ago
The first ionization energy, e, of a potassium atom is 0.696 aj. what is the wavelength of light, in nm, that is just sufficient
elena55 [62]
The formula to be used for this problem is as follows:

E = hc/λ, where h is the Planck's constant, c is the speed of light and λ is the wavelength. Also 1 aJ = 10⁻¹⁸ J

0.696×10⁻¹⁸ = (6.62607004×10⁻³⁴ m²·kg/s)(3×10⁸ m/s)/λ
Solving for λ,
λ = 2.656×10⁻⁷ m or <em>0.022656 nm</em>
6 0
3 years ago
A mechanical pencil has a mass of 47.4 grams. The volume of the pencil is 15.8 cubic centimeters. What is the density of the pen
BlackZzzverrR [31]
Density = mass over volume
so
47.4g/15.8cm^3
=3g/cm^3
4 0
3 years ago
Read 2 more answers
What functional groups of the emulsifying agent provide the hydrophilic character? Do these groups affect the pH?
podryga [215]
Following this question....
7 0
4 years ago
Read 2 more answers
Other questions:
  • Applying Gas Laws to Hot Air Balloons
    8·1 answer
  • How to write half reaction for H2O2(aq) -&gt; O2(g)
    11·1 answer
  • HELP ME PLEASE, what kind of cell is?
    14·1 answer
  • The solubility of lead(II) iodide is 0.064 g/100 mL at 20ºC. What is the solubility product for lead(II) iodide?
    15·1 answer
  • Read the list of common household substances.
    13·2 answers
  • En 200 gramos de carburo de potasio ,cuya fórmula química es K4C , Cuántos moles de esa sustancia existen ?
    9·1 answer
  • How many moles of hydrogen atoms are<br> present in 15 moles of C2H6O?<br> Answer in units of mol.
    12·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • In both biscuit recipes, why does the author begin the instructions with "Preheat oven to 450 degrees”?
    15·1 answer
  • Picture of chart is added. Please help and answer this question i will mark brainliest if question is answered correctly. Would
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!