1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
geniusboy [140]
3 years ago
11

A student is standing with their back facing a campfire. The student notices that their back is much warmer than their chest. Th

ey know that thermal energy is being transferred from the fire and that this method of energy transfer can happen even if no air is present.
This method of energy transfer is —



convection

condensation

conduction

radiation
Chemistry
2 answers:
fiasKO [112]3 years ago
8 0
Conduction because it transfers thermal energy
Mandarinka [93]3 years ago
3 0

Answer:Conduction occurs when energy is passed between objects. The transfer of thermal energy is called heat. Particles of matter are in constant motion.

Explanation:

You might be interested in
Block A has a mass of 5g and a volume of 15mL. What is the density of block A? Will it float in water (density of water is 1.0 g
iris [78.8K]

Explanation:

The density of a substance can be found by using the formula

density =  \frac{mass}{volume}  \\

From the question

mass of block = 5 g

volume = 15 mL

The density of the block is

density =  \frac{5}{15}  =  \frac{1}{3}  \\  = 0.33333333...

We have the final answer as

<h3>0.33 g/mL</h3>

The block will float on water since it's density is less than that of water which is 1 g/mL

Hope this helps you

8 0
4 years ago
What is the reason that some elements are formed inside stars and nowhere else
elena-14-01-66 [18.8K]

I think it would be answer B or D  . I gave you two answer because I dont want to be wrong with one

6 0
3 years ago
Read 2 more answers
Determine the number of moles of citric acid in 10.0 mL of pineapple juice
Korvikt [17]
It's 3/8 ths citric acid and it taste gross
7 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
What does the periodic table display
vovangra [49]

Answer:

chemical elements

Explanation:

I think

5 0
3 years ago
Read 2 more answers
Other questions:
  • A weak acid. What is the pH of a 0.1 M solution of acetic acid (pKa = 4.75)?
    7·1 answer
  • The most common method for the synthesis of unsymmetrical ethers is the Williamson synthesis, a reaction (SN2) of an alkoxide io
    8·1 answer
  • Arrange the following aqueous solutions in order of decreasing freezing point: 0.10 m Na3PO4, 0.35 m NaCl, 0.20 m MgCl2, 0.15 m
    13·1 answer
  • How long would it take for a car to travel a distance of 275 km if it is traveling at a
    12·1 answer
  • Will a precipitate of magnesium fluoride form when 300. mL of 1.1 × 10 –3 M MgCl 2 are added to 500. mL of 1.2 × 10 –3 M NaF? [K
    6·1 answer
  • Endothermic/exothermic
    9·1 answer
  • When the tide is receding (high tide to low tide) through a narrow area it can pull a large amount of water through a narrow gap
    10·1 answer
  • Another term for air movement caused by differences in air pressure is <br> Help please
    7·1 answer
  • Lithium, sodium and potassium all belong to the same group of the periodic table.
    7·2 answers
  • What are the difference between malachite and pyrite and how they are alike
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!