1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ira Lisetskai [31]
3 years ago
6

he balanced net ionic equation for precipitation of CaCO 3 when aqueous solutions of Na 2CO 3 and CaCl 2 are mixed is ________.

2Na (aq) CO32- (aq) Na2CO3 (aq) 2Na (aq) 2Cl- (aq) 2NaCl (aq) Na (aq) Cl- (aq) NaCl (aq) Ca (aq) CO32- (aq) CaCO3 (s) Na2CO3 (aq) CaCl2 (aq) 2NaCl (aq) CaCO3 (s)
Chemistry
1 answer:
ale4655 [162]3 years ago
6 0

Answer:

Net ionic equation: Ca^{2+}(aq.)+CO_{3}^{2-}(aq.)\rightarrow CaCO_{3}(s)

Explanation:

Reaction between Na_{2}CO_{3} and CaCl_{2} is an example of double decomposition reaction where each cations and anions of each salt exchange their partners during reaction to form CaCO_{3} and NaCl

CaCO_{3} is an insoluble salt. Hence precipitation of CaCO_{3} has been observed.

Molecular equation: Na_{2}CO_{3}(aq.)+CaCl_{2}(aq.)\rightarrow 2NaCl(aq.)+CaCO_{3}(s)

Total ionic equation:

2Na^{+}(aq.)+CO_{3}^{2-}(aq.)+Ca^{2+}(aq.)+2Cl^{-}(aq.)\rightarrow CaCO_{3}(s)+2Na^{+}(aq.)+2Cl^{-}(aq.)

Here Na^{+} and Na^{+} are spectator ions. Therefore they are eliminated from both side of total ionic equation to get net ionic equation.

Net ionic equation: Ca^{2+}(aq.)+CO_{3}^{2-}(aq.)\rightarrow CaCO_{3}(s)

You might be interested in
Where does a mid ocean ridge form?
Anit [1.1K]
<span>There are divergent boundaries where the plates are moving away from each other, causing magma to rise up. The boiling lava is almost immediately cooled and forms new sea floor crust.</span>
8 0
3 years ago
Based on the information in the passage, what is true of gases?
luda_lava [24]
1: True
2: True
3: False
4: False

(Question 2 might not be true, not sure)
7 0
2 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
When 12 grams of carbon react with 32 grams of oxygen, the compound carbon dioxide (a greenhouse gas) is formed. What is true ab
musickatia [10]

Answer:

Option C = 6 of carbon react with 16 g of oxygen.

Explanation:

In given question it is stated that 12 g  of carbon react with 32 g of oxygen to produce carbon dioxide. The other combination option c is also true because in this, the quantity of both reactant is just half from the given quantity. Which means that if 100 % product is obtained from the 12 g of carbon and 32 g of oxygen then by taking the half amount of reactant the product will be half i.e 50% .

This combination is true because the ratio of both reactant are justified.

Carbon 12g + Oxygen 32g → carbon dioxide

           C : O     1  : 2.6

Option C:

Carbon ( 12/2 =6g ) + Oxygen (32/2 = 16g) → Carbon dioxide

           C : O     1  : 2.6

6 0
3 years ago
The nucleus of an atom stays together only because the repulsive forces, called
Ahat [919]

Answer:

Electrostatic

Explanation:

The forces that are overcome are the repulsive electrostatic forces between the protons (all charged positively).

7 0
3 years ago
Other questions:
  • Treatment of 2-hexanone with naoch2ch3 followed by ch3br affords compound x (c7h14o) as the major product. x shows a strong abso
    13·1 answer
  • What natural method of separating mixtures happens in reservoirs over a long period of time?
    8·1 answer
  • Two isotopes of the same element will have the same _____ but a different ____. (2 points)
    13·1 answer
  • Which statement defines activation energy?
    10·2 answers
  • Maria wants to determine which type of disinfectant kills the most bacteria.
    9·2 answers
  • Conduction transfers thermal energy by____.
    13·2 answers
  • Speed is zero when a line on a graph has this shape
    13·1 answer
  • The actual yield of a product in a reaction was measured as 1.20 g. If the theoretical yield of the product for the reaction is
    7·1 answer
  • 10. What is the IUPAC name of this compound? CH3 -CH2-C =C-CH3​
    15·1 answer
  • Which is an acceleration?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!