Answer:
No.
Explanation:
No. There is 1 atom of Ca on the left and 2 Ca's on the right and 2 OH's on the left and 4 on the right.
The balanced equation is:
4OH- + 2Ca2+ ----> 2Ca(OH)2.
<span>Answer:
A 0.04403 g sample of gas occupies 10.0-mL at 289.0 K and 1.10 atm. Upon further analysis, the compound is found to be 25.305% C and 74.695% Cl. What is the molecular formula of the compound?
--------------------------------------...
Seems like I did a problem very similar to this--this must be the "B" test. But the halogen was different.
25.305% C/12 = 2.108
74.695% Cl/35.5 = 2.104
So the empirical formula would be CH. However, there are many compounds which fit this bill, so we have to use the gas data. (And I made, in the previous problem, the simplifying assumption that 289C and 1.10 atm would offset each other, so I'll do that, too.)
0.044 grams/10 ml = x/22.4 liters
0.044g/0.010 liters = x/22.4 liters
22.4 liters/0.010 liters = 2240 (ratio)
2240 x .044 = 98.56 (actual atomic weight)
CCl = 35.5+12 or 47.5, so two of those is 95 grams/mole.
This is sufficiient to distinguish C2CL2, (dichloroacetylene)
from C6CL6 (hexachlorobenzene) which would
mass 3 times as much.</span>
Protists belong to the group eukaryotes (having their DNA enclosed
inside the nucleus). They are not plants, nimals or fungi but they act like
one. They can be in general subgroups such as unicellular algae, protozoa and
molds. They thrive in environments with little sunlight. The answer is
letter B.
With the lack of these 3 factors you throw off your health triangle and your health is unbalanced. When you eat well you can get vitamins such as "E" and "C". These vitamins help build up immune cells that help build the immune system. When a person does not get enough sleep that person is more open to viruses and bacteria. Getting the recommended vaccines help you to fight off possible diseases or illnesses. They make you immune system stronger so you can be healthier.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
