1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balandron [24]
3 years ago
12

What are three possible blood type alleles?

Chemistry
2 answers:
Keith_Richards [23]3 years ago
8 0

Answer:

Three possible blood type alleles are Iᴬ, Iᴮ and i

Explanation:

Iᴬ, Iᴮ and i are three possible blood type alleles.

Iᴬ and Iᴮ are known as co-dominant, and The i allele is recessive.

Thus, Three possible blood type alleles are Iᴬ, Iᴮ and i

<u>-TheUnknownScientist</u>

artcher [175]3 years ago
3 0
There are three different alleles, known as IA, IB, and i. The IA and IB. The possible human phenotypes for blood group are type A, type B, type AB, and type O. Three or more alternative forms of a gene (alleles) that can occupy the same locus. However, only two of the alleles can be present in a single organism.
You might be interested in
Compare the information provided by a molecules chemical formula to the information provided by its structural formula
dybincka [34]
A chemical formula of a molecule is an expression which states the number and type of atoms<span> present in a </span>molecule of a substance. While the structural formula, is a formula of <span>a chemical compound that is a graphic representation of the molecular </span>structure<span>, showing how the atoms are arranged.</span>
7 0
3 years ago
For each reaction, calculate how many moles of the barium product you will produce using stoichiometry and the balanced reaction
ankoles [38]

Answer:

Explanation:

given that

mass of Ba(NO3)2 = 1.40g

mass of NH2SO3H = 2.50 g

1)to determine the mole of  Ba(NO3)2

2) to determine the mass of all three product formed in the reaction

reaction

Ba(NO3)2 + 2NH2SO3H → Ba(NH2SO3)2 + 2HNO3

<u>Solution</u>

we calculate the molar mass of each species by using their atomic masses

BA = 137.33g/mol

N = 14g/mol

O= 16g/mol

H = 1g/mol

S = 32g/mol

calculation

Ba(NO3)2 = Ba + 2N + 6O

= 137.33 + 2X 14 + 6 X 16

= 261.33g/mol

NH2SO3H = N + 3H + S+ 3O

=14 + 3X1 + 32 + 3X 16

= 97g/mol

Ba(NH2SO3)2 = Ba + 2N + 4H +2S +6O

= 137.33 + 2 X 14 + 4 X1 + 2X32 + 6 X 16

= 329.33g/mol

HNO3 = H + n + 3O

= 1 + 14 + 3 X 16

= 63g/mol

3 0
4 years ago
HELP PLEASE !!!<br> Name the gas formed when Magnesium metal reacts with hydrochloric acid
Mrrafil [7]

Answer:

<h2>hydrogen gas is produced .</h2>

6 0
3 years ago
What are the 3 main points of the kinetic molecular theory of gases
tigry1 [53]

Answer:

No energy is gained or lost when molecules collide. The molecules in a gas take up a negligible (able to be ignored) amount of space in relation to the container they occupy. The molecules are in constant, linear motion.

Explanation:

Hope this helps!

5 0
4 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
Other questions:
  • Convert 575.1 mmHg to atm
    9·1 answer
  • Which substance is an electrolyte <br> 1) CCl4 <br> 2)SiO2<br> 3)C6H12O6<br> 4) H2SO4
    13·1 answer
  • 24 kWh lithium-ion (Li-ion) battery with 84 mile range
    10·1 answer
  • explain using diagrams how potassium forms the compound potassium flouride when it reacts with flourine
    8·1 answer
  • The shape of the nucleus is maintained by
    6·1 answer
  • What are the units for standard pressure?
    7·2 answers
  • Use your knowledge of carbon-14 dating to determine which two statements are true. (remember that the half-life of carbon-14 is
    11·1 answer
  • Hexane is a chain organic compound that has the formula C6H14. What type of organic compound is hexane? Alcohol Amine Ether Hydr
    5·1 answer
  • Help me pleaseeeeeeeeeeeeeeeeeeeeeeeeee
    12·2 answers
  • Which of the following is a renewable energy source?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!