1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Amanda [17]
2 years ago
13

Sodium will do an ionic with

Chemistry
1 answer:
Nana76 [90]2 years ago
8 0
Answer : Bromine
Step by step: Bromine
You might be interested in
"11. Barium nitrate reacts with aqueous sodium sulfate to produce solid barium sulfate and aqueous sodium nitrate. Abigail place
Amanda [17]

Answer:

44 mL of Na2SO4

Explanation:

Step 1:

The balanced equation for the reaction. This is given below:

Ba(NO3)2 (aq) + Na2SO4 (aq) —> BaSO4 (s) + 2NaNO3 (aq)

Step 2:

Determination of the number of mole of Ba(NO3)2 in 20.00 mL of 0.500 M barium nitrate (Ba(NO3)2). This is illustrated below:

Molarity of Ba(NO3)2 = 0.5 M

Volume of solution = 20 mL = 20/1000 = 0.02 L

Mole of solute (Ba(NO3)2) =?

Molarity = mole /Volume

0.5 = Mole of Ba(NO3)2 / 0.02

Cross multiply to express in linear form

Mole of Ba(NO3)2 = 0.5 x 0.02

Mole of Ba(NO3)2 = 0.01 mole

Step 3:

Determination of the number of mole of Na2SO4 that reacted.

Ba(NO3)2 (aq) + Na2SO4 (aq) —> BaSO4 (s) + 2NaNO3 (aq)

From the balanced equation above,

1 mole of Ba(NO3)2 reacted with 1 mole of Na2SO4.

Therefore, 0.01 mole of Ba(NO3)2 will also react with 0.01 mole of Na2SO4.

Step 4:

Determination of the volume of Na2SO4 needed for the reaction. This is illustrated below:

Mole of Na2SO4 = 0.01 mole

Molarity of Na2SO4 = 0.225M

Volume =?

Molarity = mole /Volume

0.225 = 0.01 / volume

Cross multiply to express in linear form

0.225 x Volume = 0.01

Divide both side by 0.225

Volume = 0.01/0.225

Volume of Na2SO4 = 0.044 L

Converting 0.044 L to mL, we have

Volume of Na2SO4 = 0.044 x 1000

Volume of Na2SO4 = 44 mL

Therefore, 44 mL of Na2SO4 is needed for the reaction

6 0
3 years ago
Read 2 more answers
What is the process by which sand dunes occur?
Arte-miy333 [17]
B............................................................................
3 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
Determine the rate of a reaction that follows the rate law: rate = k[A]^m[B]^n, where k = 1.5
White raven [17]
Really I appreciate you letting you guys sleep you good though I love it all I gotta see you soon buddy I’m
3 0
1 year ago
According to "When Is a Planet Not a Planet?" scientists determined that Pluto was not a planet. What were the causes that led t
kap26 [50]
C.
D.
E.

These should be the main reasons. As Pluto was mainly categorized in dwarf planet for not being able to satisfy the last statement which states that it should have a fixed neighbourhood with other planets.
5 0
3 years ago
Other questions:
  • An electric field is created by particles that
    5·1 answer
  • Consider the reaction 2Al(OH)3(s)→Al2O3(s)+3H2O(l) with enthalpy of reaction ΔHrxn∘=21.0kJ/mol What is the enthalpy of formation
    6·2 answers
  • How many significant figures will be in the final answer of this calculation? 20.2 + 3.10 - 0.09687 = ________
    6·1 answer
  • What is the sharing of ideas and experimental findings with others through writing and speeking is called
    11·1 answer
  • Please answer ASAP I really need it is it the 1st,2nd,3rd, or 4th Anwser
    7·1 answer
  • Which group of the priodic Table contains calcuim amd magnesium? Give reason for your answer.<br>​
    11·1 answer
  • An apple appears red when struck by white light. This appearance is because the red light is reflected and the other colors are
    10·1 answer
  • When the moon is between the earth and the sun what moon phase will this be
    5·2 answers
  • how does the total mass of each object increases the amount of force that is needed to get them moving at 5 m/s increase by abou
    15·1 answer
  • How many meters are in one yard? 1m=1.09​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!