1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
3 years ago
10

46 POINTS!!! help me with chemistry, please!

Chemistry
1 answer:
castortr0y [4]3 years ago
4 0

Answer:

are you sure it is 95%?????

Explanation:

You might be interested in
Given these reactions, where X represents a generic metal or metalloid 1) H2(g)+12O2(g)⟶H2O(g)ΔH1=−241.8 kJ 1) H2(g)+12O2(g)⟶H2O
Bond [772]

Answer:

ΔH = -793,6 kJ

Explanation:

It is possible to obtain ΔH of this reaction using Hess's law that says you can sum the half-reactions ΔH to obtain the ΔH of the global reaction:

If half-reactions are:

1) H₂(g) + ¹/₂O₂(g) ⟶ H₂O(g) ΔH₁ = −241.8 kJ

2) X(s) + 2Cl₂(g) ⟶ XCl₄(s) ΔH₂ = +356.9 kJ  

3) ¹/₂H₂(g) + ¹/₂Cl₂(g) ⟶ HCl(g) ΔH₃ = −92.3 kJ

4) X(s) + O₂(g) ⟶ XO₂(s) ΔH₄ = −639.1 kJ

5) H₂O(g) ⟶ H₂O(l) ΔH₅ = −44.0 kJ

The sum of (4) + 4×(3) - (2) - 2×(1) - 2×(5) is:

(4) X(s) + O₂(g) ⟶ XO₂(s) ΔH = −639.1 kJ

+4×(3) 2H₂(g) + 2Cl₂(g) ⟶ 4HCl(g) ΔH = −369,2 kJ

-(2) XCl₄(s) ⟶ X(s) + 2Cl₂(g) ΔH = -356,9 kJ

-2×(1) 2H₂O(g) ⟶ 2H₂(g) + O₂(g) ΔH = +483,6 kJ

-2×(5) 2H₂O(l) ⟶ 2H₂O(g) ΔH = +88.0 kJ

= <em>XCl₄(s) + 2H₂O(l) ⟶ XO₂(s) + 4HCl(g)</em>

Where ΔH is:

ΔH = -639,1 kJ -369,2 kJ -356,9 kJ +483,6 kJ +88,0 kJ

<em>ΔH = -793,6 kJ</em>

I hope it helps!

5 0
3 years ago
What gives the gem amethyst its purplish color?
Alina [70]
iron Presence of trace elements, irradiation and iron impurities give the gem amethyst its purplish color!
7 0
3 years ago
The oxidation state of phosphorus is +3 in
IgorC [24]

Answer:

b) Phosphorus acid

Explanation:

To distinguish the type of acid of phosphorus with the oxidation state of +3, we need to be familiar with the chemical formula of each of the compounds:

    Orthophosphoric acid             H₃PO₄

    Phosphorus acid                       H₃PO₃

    Metaphosphoric acid               HPO₃

    Phyrophosphoric acid​               H₄P₂O₇

Now that we know the formula of the given compounds, the algebraic sum of all the oxidation numbers of all atoms in a neutral compound is zero:

Only phosphorus acid yielded an oxidation state of +3 for phosphorus in the compound.

  H₃PO₃:

   we know the oxidation state of H = +1

                                                          O = -2

         The oxidation state of P is unknown. We can express this as an equation:

                3(+1) + P + 3(-2) = 0

                    3 + P -6 = 0

                          P-3 = 0

                          P = +3

6 0
3 years ago
UUUUUULUHU Urgull (ULLO
timama [110]

Answer:

Plants are found in the domain of eukarya

7 0
3 years ago
PLS I NEED HELP with steps WILL GIVE BRAINLIEST
RideAnS [48]

Answer:

Please subscribe to my channel Symbol YT then I will answer your question

8 0
3 years ago
Other questions:
  • Im teaching myself chemistry and need a guide. anyone game?
    15·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • A curved piece of glass or other transparent material that is used to refract light is called a (an) _____.
    10·2 answers
  • What is magnesium used for in its pure form
    15·1 answer
  • 4. One mole of oxygen contains 6.02 x 102 molecules. How many oxygen molecules are in
    11·1 answer
  • HELPPP PLZZ :/
    13·2 answers
  • Is a cold and b is warm? Please help
    10·1 answer
  • Write a causal question based on the information in the passage
    7·1 answer
  • On an artificial reef in the Mediterranean Sea, the rocky bottom, the Dover sole, and the
    15·1 answer
  • Solid iron combines with oxygen gas to form solid iron(III) oxide. Which of the following equations best describes this reaction
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!