1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arsen [322]
3 years ago
13

Please help I’ll give brainiest. !! Thanksss

Biology
1 answer:
hodyreva [135]3 years ago
6 0

Answer:

Friction make stuff go the opposite way sot the ball wound go to the left bc of fiction and the ball would go to the right for motion

Explanation:

You might be interested in
Altocumulus and altostratus clouds usually bring which of the following types of weather? a. light snow or rain
Tju [1.3M]
Altocumulus and altostratus clouds usually bring cold, windy conditions. If you come across this type of weather make shure you are protected from drizzle or light snow.
6 0
3 years ago
Read 2 more answers
What is the maximal interval for pausing chest compressions?
shusha [124]
When an advanced airway is in place, it may be reasonable for a rescuer to deliver 1 breath every 6 seconds<span> during continuous chest compressions. It may be reasonable to immediately resume chest compressions after shock delivery without a pause for a rhythm check.</span>
3 0
3 years ago
The chart shows the total amount of nitrogen oxides (NOx) and sulfur dioxide (SO2) that coal-fired utilities emitted between 199
horsena [70]

Answer:

Yes.

Explanation:

If the graph line comes lowers from 1999 to 2013 so it means that steps taken by the EPA and the factories were effective in reducing air pollution. The steps taken by the EPA and the factories were effective in reducing air pollution occurs from two pollutants i. e nitrogen oxides (NOx) and sulfur dioxide (SO2) if they install chimneys which collect these gases and reduce pollution. if the factories uses coal having less concentration of sulphur so less air pollution occurs.

4 0
3 years ago
Read 2 more answers
BRAINLIEST ANSWER TO FIRST COMMENT
LiRa [457]
Different ORGANISMS!
6 0
3 years ago
A meter is a unit of length.how many meters are there in one kilometer?
Scilla [17]
1000 meters are in a kilometer
3 0
3 years ago
Other questions:
  • True or False. An ergometer is a device that accurately measures caloric expenditure.
    7·1 answer
  • Every time there is a full moon, Mrs. Cook insists that students in her classes display strange behavior. What would be the best
    11·1 answer
  • Which climate covers most of India
    10·2 answers
  • Which of these organisms have the greatest amount of cell specialized
    8·1 answer
  • What holds the base pairs of dna together
    13·1 answer
  • What systems make up the marine iguana?
    9·1 answer
  • The number of different species in the biosphere or in a particular area is called
    12·1 answer
  • What was the average of diameters (cm) for the Willapa Bay urchins sampled before the hunt? (Type just the number rounded to the
    11·1 answer
  • Which of the following means 'returning<br> the land to its original condition'?
    13·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!