1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
QveST [7]
3 years ago
6

Which substance below exhibits the weakest intermolecular forces?

Chemistry
1 answer:
mestny [16]3 years ago
6 0

Answer:

SO2

Explanation:

You might be interested in
Natasha and Reanna observe a large airplane in the troposphere. Which experimental setup below would best determine how changing
snow_lady [41]

Answer:

i am pretty sure the answer is a

Explanation: because the airplane's flight time has to be the independent variable for it to affect the dependent variable that is the speed of how fast the airplane is going.

8 0
3 years ago
Read 2 more answers
Ratio of atoms in Hydrochloric acid
Lesechka [4]

One to one ratio

The formula of hydrochloric acid is HCl so there is one atomic of hydrogen and one atom of oxygen

7 0
3 years ago
In what type of reaction will an acid and a base react with each other
Arada [10]
<span> When an </span>acid and a base<span> are placed together, they </span>react<span> to neutralize the </span>acid<span> and </span>base<span> properties, producing a salt. The H(+) cation of the </span>acid<span>combines with the OH(-) anion of the </span>base<span> to form water.</span>
6 0
3 years ago
Read 2 more answers
What PROPERTIES of elements visibly show periodic trends when their values are graphed?
Scrat [10]
I believe the major periodic trends include; electronegativity, ionization energy, electron affinity, atomic radius, melting point, and the metallic character. Periodic trends, arising from the arrangement of the periodic table, provide chemists with an invaluable tool to quickly predict an element's property.
3 0
3 years ago
Select the letter of a category on which you should focus when proofreading.
oee [108]
B. Who, what, when, where, why, and how. Those are the most important and key componants in a story.
8 0
3 years ago
Other questions:
  • Which statement describes the valence electrons in ionic bonds?
    8·2 answers
  • 3) A certain reaction has the following general form: A + B à AB At a particular temperature the concentration versus time were
    15·1 answer
  • Can someone confirm that this is right?
    13·1 answer
  • How many oxygen molecules are needed to make 10 carbon dioxide molecules according to the following balanced chemical equation?
    5·1 answer
  • Which statement accurately describes binary star systems?
    10·2 answers
  • Which of the following is not true about both scientific laws and scientific theories?
    12·2 answers
  • Which sphere is dependent on all the other spheres in order to exist?
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • You need to make 10.0 L of 1.2 M KNO3. What molar ( concentration) would the potassium nitrate solution need to be if you were t
    6·1 answer
  • What is the term for the number of protons in the nucleus of each atom of an element?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!