As we know that
<span>V1/T1 = V2/T2
V1 = 9.10 L
T1 = 471 K
V2 = 2.50 L
T2 = 2.5 x 471 / 9.10 = 129.3 K
T2 = 129.3 - 273 =
-143.6 deg Celsiu
hope it helps</span>
Answer: 72 grams of 
are needed to completely burn 19.7 g 
Explanation:
According to avogadro's law, 1 mole of every substance weighs equal to molecular mass and contains avogadro's number 
of particles.
To calculate the number of moles, we use the equation:
Putting in the values we get:
According to stoichiometry:
1 mole of 
requires 5 moles of oxygen
0.45 moles of require= 
moles of oxygen
Mass of 
72 grams of are needed to completely burn 19.7 g
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
I don't fully understand your question, but I believe that plants have functions that are vital to the planet. They take sunlight, make it into food for themselves, and release oxygen that we need to survive.
An educated guess is called estimation
