1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fofino [41]
2 years ago
6

A compound formed with potassium and bromine that can detect blood in a stain by reacting with it to form distinctive crystals

Chemistry
1 answer:
wel2 years ago
7 0

Answer:

Potassium Bromide

Explanation:

not sure but i think thats it

You might be interested in
Which half-reaction is most easily oxidized?
netineya [11]
From the ones that you are showing me <span>the more positive the potential the more likely: </span>

<span>Fe+3 + e- ---> Fe+2
I hope this is something very useful</span>
7 0
3 years ago
Read 2 more answers
A gas mixture contains 1.61 moles of hydrogen and 2.31 moles of oxygen. What is the mole fraction of oxygen?
agasfer [191]

Answer: option B. 0.59

Explanation:Please see attachment for explanation

5 0
3 years ago
Which statement below best describes mutations?
Studentka2010 [4]

Answer:

C. Mutations are a change in DNA or a chromosome and can be helpful, harmful or may have no affect.

Explanation:

  • Mutations are spontaneous random changes that occurs in the genetic make up of an organisms. Mutations are rare and their rate of occurrence is random.
  • Mutations may occur on the gene level known as gene mutations or at chromosome levels called chromosomal mutations.
  • Mutations may be beneficial, harmful or have no effect on a given organisms. Harmful mutations cause disorders that may lead to abnormality or death of an organisms. Beneficial mutations improve an organisms adaptability to the environment.
8 0
3 years ago
What are the two properties of Graphite that are different from the properties of Diamond?
Rus_ich [418]

Answer:

Graphite is insoluble in water and organic solvents - for the same reason that diamond is insoluble. Attractions between solvent molecules and carbon atoms will never be strong enough to overcome the strong covalent bonds in graphite. conducts electricity.

Explanation:

Brainlest please?

5 0
3 years ago
Which of the following is a chemical change?
frutty [35]
C. rusting is the correct answer
3 0
3 years ago
Other questions:
  • The _____ biome is the driest. Common floras are cacti, and faunas are snakes and lizards.
    7·2 answers
  • Name: Date:
    11·1 answer
  • Where is feces stored before excretion?<br> small intestine<br> stomach<br> urethra<br> rectum
    6·2 answers
  • A protein subunit from an enzyme is part of a research study and needs to be characterized. A total of 0.145 g of this subunit w
    8·1 answer
  • How many significant digits are in 0.0038020 ?
    9·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The tip of a match is ignited as it is struck against the matchbox. Why is this a chemical change? a.The color of the match tip
    9·2 answers
  • What is the golgi complex nickname
    8·2 answers
  • What type of reaction is the following
    13·1 answer
  • What is the empirical formula for the molecular formula given? Molecular formula: C5H12O
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!