1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arada [10]
3 years ago
7

Which arrow or arrows represent reactions that demonstrate a conservation of mass and energy? Explain your answer

Chemistry
1 answer:
rewona [7]3 years ago
6 0
I think it would be the sun because it’s the one giving energy to most things, and if you haven’t answered it yet you can put the sun because it’s giving energy to the plans and the environment and it’s the the sun was the effect of the whole thing, sorry if I didn’t help
You might be interested in
Glucose, c6h12o6, is used as an energy source by the human body. the overall reaction in the body is described by the equation
Art [367]
Glucose is carbohydrate and a simple sugar that is very important to the human body.

Energy is produced for the cells in the body through the process of metabolism which oxidizes glucose to water, carbon dioxide, and some nitrogen compounds. 

The general chemical reaction equation for metabolism is:
 
C6H12O6 + 6O2 ---> 6CO2 + 6H2O 
4 0
4 years ago
A compound is found to contain 50. 05% sulfur and 49. 95% oxygen by mass. What is the empirical formula for this compound? SO S2
jekas [21]

The empirical formula for the given compound has been \rm SO_2. Thus, option C is correct.

The empirical formula has been the whole unit ratio of the elements in the formula unit.

<h3>Computation for the Empirical formula</h3>

The given mass of Sulfur has been, 50.05 g

The given mass of oxygen has been 49.95 g.

The moles of elements in the sample has been given by:

\rm Moles=\dfrac{Mass}{Molar\;mass}

  • Moles of Sulfur:

\rm Moles\;S=\dfrac{50.05}{32}\\&#10; Moles\;S=1.56\;mol

The moles of sulfur in the unit has been 1.56 mol.

  • Moles of Oxygen:

\rm Moles\;O=\dfrac{49.95}{16} \\&#10;Moles\;O=3.12\;mol

The moles of oxygen in the unit has been 3.12 mol.

The empirical formula unit has been given as:

\rm S_{1.56}O_{3.12}=SO_2

Thus, the empirical formula for the given compound has been \rm SO_2. Thus, option C is correct.

Learn more about empirical formula, here:

brainly.com/question/11588623

8 0
2 years ago
a square boat made from iron has overall dimensions of 2.00 cm x 11.0 cm x 11.0 cm. it has a mass of 213 g. water has a density
Stolb23 [73]
Density of boat  =  \frac{MASS}{VOLUME}
                           
                          =  \frac{213 g}{(2 cm  *  11 cm  *  11cm)}
 
                          =   0.88 g / cm³

Since the density of water is greater than the density of the boat ( 1 > 0.88) then that means, the boat will NOT sink.

B.

4 0
3 years ago
Read 2 more answers
Sunspots sit on the sun’s
Crank

The answer is Photosphere Apex.      

7 0
3 years ago
A marble rolls off horizontally from the edge of table top 1.50 m above the floor. it strikes the floor 2.0 m from the base of t
GrogVix [38]

a. t=0.553 s

b. vox(horizontal speed) = 3.62 m/s

<h3>Further explanation</h3>

Given

h = 1.5 m

x = 2 m

Required

a. time

b. vo=initial speed

Solution

Free fall motion

a. h = 1/2 gt²(vertical motion=h=voyt+1/2gt²⇒voy = 0)

\tt t=\sqrt{\dfrac{2h}{g} }

t = √2h/g

t = √2.1.5/9.8

t=0.553 s

b. x=vox.t(horizontal motion)

\tt x=v_{ox}\times t

vox=x/t

vox=2/0.553

vox=3.62 m/s

3 0
3 years ago
Other questions:
  • Draw the lewis formula for chlorobenzene, a benzene derivative. include all hydrogen atoms and lone pairs.
    8·1 answer
  • Electrons have almost no mass. True False
    8·2 answers
  • For most atoms, a stable configuration of electrons is attained when the atom __________. hints hint 1. (click to open) for most
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • How many moles of oxygen are needed to completely react with 9.5 g of sodium
    11·1 answer
  • The following properties are either physical or chemical. Which one is different from the rest based on those two category? A.)
    9·2 answers
  • What dose the word scientific method means
    15·1 answer
  • And with solution...
    10·1 answer
  • 2NBr3 + 3NaOH – N2 + 3NaBr + 3HBrO
    12·1 answer
  • 1CO₂ (g) + 1C (s) → 2CO (g)<br> Keq =
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!