Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
lava is coming from the crust
Explanation:
volcano's explode with lava because the crust pushes it out
Answer:
c) +2 to 0
Explanation:
SO4 has a charge of -2, so the Cu attached to that has to be a +2 since the polyatomic molecule has no overall charge
Cu(s) is a solid metal and they have no charge, therefore it is zero
Copper undergoes Oxidation (gain of electrons)
Answer:
Explanation:
You would have to add up the atomic masses of all the compounds in the compound, making sure you include how many molecules of each are in the compound
For example, in CuSOA we have 1 molecule of Cu and S, as 4 molecules of O
The atomic masses are as follows:
Cu = 63.55 u
S = 32.065 u
O = 15.99 units
This is how we would add it up:
(Atomic mass of Cu) + (Atomic mass of S) + 4(Atomic Mass of O)
(63.55) + (32.065) + 4(15.99)
(63.55) + (32.065) + 63.96
= 159.575 u
Safety glasses should be worn any time you are doing an experiment, especially one that involves chemicals or chemical reactions. They prevent chemicals or other materials from getting on or in your eye, and can prevent anything from mild discomfort to permanent blindness.
Some pairs of safety glasses have magnifying glasses on them, similar to bifocals. They can be used to more carefully examine something in an experiment.
