1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sp2606 [1]
2 years ago
8

1. Geologists use physical properties to identify minerals. For example, the blank

Biology
1 answer:
Agata [3.3K]2 years ago
8 0

Answer:

The correct answer is - crystal form (external shape).

Explanation:

Physical properties are used for the identification of the minerals that include specific gravity, streak, texture, luster color, hardness, cleavage, and crystal form.

The most common physical property of the minerals in crystal form or external shape of the mineral. This is the property of the mineral that gives an idea about the homogenous possessing a 3-D internal order.

You might be interested in
During what process in the cell cycle does one cell become two cells? anaphase telophase prophase cytokinesis
Sonja [21]

Answer:

cytokinesis

Explanation:

4 0
3 years ago
Read 2 more answers
Do Caribou fight to attract females?
Contact [7]
Yes because who ever wins gets the girl
3 0
3 years ago
Read 2 more answers
The division of prokaryotes occurs by a process knpwn as
murzikaleks [220]

The cell division process of prokaryotes, called binary fission

Hope this helps! have an amazing day :)

3 0
3 years ago
Please select the word from the list that best fits the definition an area of high flat land​
kirill115 [55]

Answer:

plateau

Explanation:

A high flat land is called a plateau. The word "plateau" is French in origin meaning "flat"

Hope this helps :)

8 0
3 years ago
Read 2 more answers
Which of the following steps has not yet been accomplished by scientists studying the origin of life?
EastWind [94]

Answer:

The correct answer is option c. "formation of protocells that use DNA to direct the polymerization of amino acids".

Explanation:

The polymerization of amino acids is a complex biological function that involves multiple proteins and cofactors working together at different locations in the cell. Even though there are some scientific advances in the production of synthetic protocells (cell like structures made from synthetic particles), the formation of protocells able to synthesize amino acids from DNA directly has not been accomplished.

3 0
3 years ago
Other questions:
  • Child has blood types b, rh–, and m. his mother has blood types o, rh+, and mn. give the genotype of the mother, and the possibl
    9·1 answer
  • A pedigree chart like this one is characteristic of ______ disorders.
    15·2 answers
  • The biosphere is all the parts of the Earth that _____?
    15·1 answer
  • 2. Which of the following might be a result of a disease that causes a thickened plasma membrane?
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The food additive red dye no. 2 is known to cause cancer. as such, it is a __________.
    9·1 answer
  • 5. The suffix -ate means “to act on.” If the word values means “principles or standards we consider important,” what is the mean
    14·1 answer
  • Which Chemicals are major contributors to the Ozone layer destruction? Select TWO answer choices.
    12·2 answers
  • Which is true regarding the process of meiosis I?
    11·1 answer
  • Which of the following accurately describes the process of hearing?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!