1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zalisa [80]
3 years ago
11

]The image shows groundwater zones.

Chemistry
2 answers:
dezoksy [38]3 years ago
8 0
Zone 4
Explanation:
The phreatic zone, or zone of saturation, is the part of an aquifer, below the water table, in which relatively all pores and fractures are saturated with water. Above the water table is the vadose zone.
The area between the top of the water table and beginning of bedrock/impermeable rock is the saturated zone.
11111nata11111 [884]3 years ago
7 0

Answer:

C.) 3 is the correct answer

You might be interested in
What unit is used to measure cell potential?
Lilit [14]

Volt is the unit to measure cell potential.

Explanation:

The cell potential is the measure of potential difference in the two halves of the electrochemical cell.

It is the measure of how much voltage exists between the two halves of the battery. The unit of volt is joule/coulomb. The cell potential is measured by voltmeter.

The energy per unit charge from the oxidation-reduction reaction to drive the reaction is cell potential.

3 0
3 years ago
Which equation will you use to calculate the volume of a 5.00 liter sample of air at 50°C when it is warmed to 100°C at constant
Alexandra [31]
I believe it's a proportion of volume over temperature = volume and temperature. cross multiply and divide and see what u get. if it looks right go fro it if not try something else. I hope this helps!
6 0
3 years ago
Read 2 more answers
Law of conservation of mass to explain why a chemical equation must be balanced?
SOVA2 [1]
Chemical equations must always balance due to the principles outlined in The Law Of Conservation of Matter. This scientific law states that matter cannot be created out of nothing nor can it be destroyed.
7 0
3 years ago
Read 2 more answers
Why isn't energy ever truly destroyed? ​
lakkis [162]

Answer:

In physics, the law of conservation of energy states that the total energy of an isolated system cannot change—it is said to be conserved over time. ... Energy can be neither created nor destroyed, but can change form; for instance, chemical energy can be converted to kinetic energy.

Explanation:

8 0
3 years ago
Read 2 more answers
Why do both nuclear and chemical<br> changes occur?
kari74 [83]

Answer:

The change in energy for a chemical reaction has to do with the potential energy of the electrons. The change in energy for a nuclear reaction has to do with the potential energy of the nucleus. The change in energy for a nuclear change is many orders of magnitude larger than for a chemical change.

4 0
3 years ago
Other questions:
  • Calculate the fraction of atoms in a sample of argon gas at 400 K that have an energy of 12.5 kJ or greater. Report your answer
    14·1 answer
  • (c)
    8·1 answer
  • Is 8 inches enough to satisfy a girl
    6·2 answers
  • What influences attraction for electrons?
    11·2 answers
  • Can anyone please help me with this question?? Please
    15·1 answer
  • Aton Van Leeuwenhoek was the first scientist to discover prokaryotic organisms. These single-celled organisms lack a nucleus and
    12·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Element that is pale-yellow
    9·2 answers
  • Science
    7·1 answer
  • describe how knowledge of the periodic table would be important in three different careers, based on what you’ve read.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!