1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marizza181 [45]
2 years ago
11

All of the following are diseases caused by viruses except:

Biology
2 answers:
dangina [55]2 years ago
6 0

Answer: The answer you're looking for is A Strep throat

seraphim [82]2 years ago
6 0

Answer:

a} Strip throat

Explanation:

You might be interested in
What environmental worldview is seen by critics as focused on short-term economic benefits with little regard for long term harm
attashe74 [19]
I believe the answer is the global free-market approach.
It is because on continually increasing use of earth's natural capital, and it focuses on short term economic benefits with little regard for degradation and depletion of natural capital and resulting long-term harmful environmental, health, and social consequences. Environmental world views are the ways of thinking about how the world work and beliefs that people hold about their roles in the natural world, another factor is widespread lack of understanding of how earth's life-support system works, keeps us alive, and supports economies. 
6 0
3 years ago
IF most of the energy we use on earth comes from the sun –how does that energy (light and thermal) end up
____ [38]

Answer:

1: Chemical Energy

2: Kinetic Energy

3: Electrical Energy

4: Mechanical Energy

Explanation:

1: The energy held in food is called <em>chemical energy. </em>It is a form of <u>potential energy</u> held within chemical bonds between atoms.

2: When flowing water is captured and turned into electricity, it is called hydroelectric power or hydropower. There are several types of hydroelectric facilities; they are all powered by the <em>kinetic energy of flowing water</em> <u>as it moves downstream.</u>

3: The power for lights and stuff is <em>Electrical</em><em> </em><em>Energy</em><em>,</em> ofc :]

4: The <u>chemical energy in the food</u> gets changed into the <em>mechanical energy</em> of <u>moving muscles.</u>

<u>Hope</u><u> </u><u>this</u><u> </u><u>helps</u><u>!</u><u>!</u><u> </u><u>:</u><u>D</u>

5 0
2 years ago
What is the shape of DNA?
Gwar [14]
Double helix is the correct answer
4 0
2 years ago
How do molecular biologists identify genes in sequences of DNA?
oee [108]

By looking for promoters that are binding sites for RNA polymerase. It's an open reading frame and introns as well as exons
4 0
3 years ago
An_____looks like a circle with two longer, flatter sides.
MariettaO [177]

Answer:

C an ellipse

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • 1. What is the total magnification of an object if the ocular lens magnification is 20x and the objective lens magnification is
    15·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Why is transcription essential for making proteins
    7·2 answers
  • In a living organism, what is a tissue?
    12·2 answers
  • Summarize where carbon is found on Earth and how much of it is in the human body
    15·1 answer
  • A student wrote steps to show the energy transformations involved in producing, eating, and digesting food. Which step shows an
    6·1 answer
  • Explain the process of digestion abd absorption of carbohydrates.​
    15·1 answer
  • Which is an a word that shows the outlet isn't completely sure about a particular statement
    12·1 answer
  • Which list gives key events regarding the exploration of space in the correct order, beginning with the earliest? (1 point) PLEA
    14·1 answer
  • What makes an energy resource non-renewable? <br><br>Please explain well, will give brainliest.​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!