Potential energy is energy due to an object's height above the ground.
Potential energy = mass x gravity x height
Kinetic energy is energy due to the motion of the object.
Kinetic energy = 1/2 x mass x velocity²
1.
The ball is not moving and is at a height above the ground so it has only potential energy.
P.E = 2 x 9.81 x 40
P.E = 784.8 J
2.
The ball is moving and has a height above the Earth's surface so it has both kinetic and potential energy.
P.E = same as part 1 = 784.8 J
K.E = 1/2 x 2 x 5²
K.E = 25 J
3.
The ball has no height above the Earth's surface and is moving so it has only kinetic energy.
K.E = 1/2 x 2 x 10²
K.E = 100 J
4.
50000 = 1/2 x 1000 x v²
v = 10 m/s
5.
39200 = 200 x 9.81 x h
h = 20.0 m
6.
12.5 = 1/2 x 1 x v²
v = 5 m/s
98 = 1 x 9.81 x h
h = 10.0 m
Answer:
B .Through testing a theory about the physical world
Explanation:
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
- <u>You need to convert the number of atoms of Ca into mass in grams, using Avogadro's number and the atomic mass of Ca.</u>
Explanation:
The amount of matter is measured in grams. Thus, you need to convert the number of atoms of Ca (calcium) into mass to compare with 2.45 grams of Mg.
To convert the atoms of calcium into mass, you divide by Avogadro's number, to obtain the number of moles of atoms, and then divide by the atomic mass of calcium.
<u />
<u>1. Number of moles, n</u>
<u />
<u>2. Mass</u>
- mass = number of moles × atomic mass
- mass = 0.053969mol × 40.078g/mol = 2.16g
Then, 2.45 g of Mg represent a greaer mass than the 3.25 × 10²² atoms of Ca.
Heat energy can be calculated by using the specific heat of a substance multiplying it to the mass of the sample and the change in temperature. It is expressed as:
Energy = mCΔT2520= 10.0(C) (70.0 - 10.0)C = 4.2 J/ kg K
