Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
First, calculate for the amount of heat used up for increasing the temperature of ice.
H = mcpdT
H = (18 g)*(2.09 J/g-K)(50 K) = 1881 J
Then, solve for the heat needed to convert the phase of water.
H = (1 mol)(6.01 kJ/mol) = 6.01 kJ = 6010 J
Then, solve for the heat needed to increase again the temperature of water.
H = (18 g)(4.18 J/gK)(70 k)
H = 5266.8 J
The total value is equal to 13157.8 J
Answer: 13157.8 J
Answer:
Explanation:
Penguins have webbed feet to help them swim, waterproof feathers and very good vision underwater , they also have thick skin and blubber to help them keep nice and warm so they can have fun and fish for food with out worrying about being very cold. Hope that helped UwU
Because mass is not always the same for objects made from the same material. Just because an object has the same mass as another doesn’t mean they are the same material.