Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
3.
D. Philippine Atmospheric, Geophysical and Astronomical Services
Administration (PAGASA)
Explanation:
4.C. 62.0 kph
<em><u>A molecule </u></em><em><u>can </u></em><em><u>possess polar bonds and still be nonpolar.</u></em>
I hope this helped. Have a nice day, make sure to take care of yourself. You're loved <3
Answer:
Explanation:
A. Linear Relationships
x 2 4 6 8 10 12
y 4.4 8.8 13.2 17.6 22 26.4
(you can plot this by using the (x,y) coordinates for each pair above.)
B. y=2.2x
mass is 2.2 times larger than the volume.
C. The mass is 2.2 times the volume.
