1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Musya8 [376]
3 years ago
15

Which of the following is true?

Chemistry
1 answer:
Harlamova29_29 [7]3 years ago
5 0

Answer:

If we know that a reaction is an elementary reaction, then we know its rate law.

Explanation:

An elementary reaction is a reaction that takes place in one reactive encounter. This means that the two species interact in a single step to give the products.

If two reactants interact in a single step to yield the products then we can easily deduce the rate law from the reaction equation.

For instance, For the reaction;

2A + B → C

The rate law is

rate = k[A]²[B].

If the reaction is an elementary reaction and the equation of the reaction is balanced, then we can deduce the rate law from the balanced reaction equation.

You might be interested in
Joe the scientist wants to figure out the angle for throwing a football that
Solnce55 [7]

Answer:

C

Explanation:

7 0
3 years ago
Read 2 more answers
Need science help (screenshot included)
Dima020 [189]

A. False. If it is high tide in one place on Earth, the place exactly opposite to it will also have a <em>high</em> tide.

The gravitational attraction of the Moon and the inertia of the oceans cause <em>two tidal bulges </em>on opposite sides of the Earth.

B. True. Cassini used flybys of Venus, Earth and Jupiter as slingshots to reach Saturn.

C. True. The whole solar system moves around the galaxy.

D. True. If a planet’s gravity is not strong enough, the molecules in its atmosphere will have enough kinetic energy to escape into space.

E. False. The <em>mass of an object is constant</em>, but its <em>weight changes</em> according to the gravity of the planet.

F. False. To find the mass of an object, <em>divide</em> its weight by gravity.

F = mg  or weight = mass × gravity

∴ <em>Mass = weight/gravity </em>

6 0
3 years ago
Calculate the solubility of benzene in water at 25 c in ppm. the required henry's law constant is 5.6 bar/mol/kg and benzene's s
kap26 [50]

The relationship between pressure and solubility of the gas is given by Henry's law as:

S_g = kP_g

where,

S_g is the solubility of the gas.

k is proportionality constant i.e. Henry's constant.

P_g is pressure of the gas.

k = 5.6 bar/mol/kg (given)

P_g = 0.13 bar (given)

Substituting the values,

S_g = 5.6 bar/mol/kg\times 0.13 bar = 0.728 mole/kg

To convert mole/kg to g/kg:

Molar mass of benzene, C_6H_6 = 6\times 12+6\times 1 = 78 g/mol

0.728\times 78 = 56.784 g/kg

Now for converting into ppm:

Since, 1 ppm = 0.001 g/kg

So, 56.784\times 1000 = 56784 ppm.

Hence, the solubility of benzene in water at 25^{o} C in ppm is 56784 ppm.


7 0
3 years ago
Which of the following can explain the daily change in sea level observed along a coast?
salantis [7]
The answer for the question above is A. the gravitational pull of the moon on the water near the coast. The sun and and the moon are responsible for the rising and falling of the ocean tides. The gravitational pull of the moon and the sun makes the water in the oceans bulge, causing a continuous change between high and low tide. 
5 0
3 years ago
UNIT TEST
Aleksandr-060686 [28]

Answer:

Six

Explanation:

I just took it and that is the correct answer.

8 0
3 years ago
Other questions:
  • A football field is about 100 m long. If it takes a person 20 seconds to run its length, how fast were they running ?
    6·1 answer
  • Which of the following is a substance that is found between the cell membrane and the nuclear us which primarily consist of wate
    15·1 answer
  • How does an atom differ from a molecule? In what ways are they similar?
    13·1 answer
  • If the density is 0.1 g/cm^3 and the volume is 5cm^3, what is the mass?
    7·1 answer
  • One of the hopes for solving the world's energy problem is
    12·1 answer
  • You are given an unknown sample that when treated with hydrochloric acid forms a precipitate. After decantation, you add boiling
    11·1 answer
  • Which is an example of the flow of heat through conduction?
    13·2 answers
  • Which components of a galaxy move in circular patterns or revolve around a star?
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • 1. Which list of nuclear emissions is arranged in order from the least penetrating power to
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!