It is an example of physical change. The molecules are not changing, so it is not chemical, and a physical property is something that a physical thing has.
Answer:
B
Explanation:
The sun can be dangerous but it also helps our Earth in a lot of ways
Answer:
1223.38 mmHg
Explanation:
Using ideal gas equation as:
where,
P is the pressure
V is the volume
n is the number of moles
T is the temperature
R is Gas constant having value = 
Also,
Moles = mass (m) / Molar mass (M)
Density (d) = Mass (m) / Volume (V)
So, the ideal gas equation can be written as:
Given that:-
d = 1.80 g/L
Temperature = 32 °C
The conversion of T( °C) to T(K) is shown below:
T(K) = T( °C) + 273.15
So,
T = (32 + 273.15) K = 305.15 K
Molar mass of nitrogen gas = 28 g/mol
Applying the equation as:
P × 28 g/mol = 1.80 g/L × 62.3637 L.mmHg/K.mol × 305.15 K
⇒P = 1223.38 mmHg
<u>1223.38 mmHg must be the pressure of the nitrogen gas.</u>
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
