1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NNADVOKAT [17]
2 years ago
6

state the conditions under which copper reacts with sulphuric (vi) acid and give an equation for the reaction​

Chemistry
1 answer:
uranmaximum [27]2 years ago
3 0

Answer:

When the metal reacts with hot, concentrated sulphuric acid, the products of the reaction are copper (II) sulphate, sulphur dioxide and water. Cu + 2H2SO4 = CuSO4 + SO2 + 2H2O. This is a typical redox reaction in which the acid is reduced to SO2, but no hydrogen is produced here

You might be interested in
Because of its high reactivity which element is normally obtained by the electrolysis
katrin [286]

<span>Lithium has a property of high reactivity and to obtain lithium is through electrolysis of its fused salts. Because lithium is very reactive, it is not found free so electrolysis is use to split it apart to get it.  Moreover, Lithium is an alkali metal with single valence electron that is easily given up to form cation, which make it a good conductor of heat and electricity.</span>

<span> </span>

8 0
3 years ago
How many kilometers are in a 7.21. mm
Readme [11.4K]

Answer:

0.00000721 Kilometer

6 0
2 years ago
Select the correct answer.
Nitella [24]

Answer:

C.

Explanation:

Iron is most likely to form a precipitation reaction.

8 0
3 years ago
La TEMPERATURA es un cambio físico o Químico?
gladu [14]
La temperatura es un cambio físico
6 0
3 years ago
Convert 7.34 miles into meters (1mile = 1.6 Km)
Lera25 [3.4K]

Answer:

11812.58 meters = 11.81258 Km

Explanation:

hope that helps

8 0
3 years ago
Other questions:
  • The chart indicates the time, speed, and velocity of five runners.
    6·1 answer
  • How much of a 1.00 mg sample of americium remains after 3 half-lives?
    13·2 answers
  • In the process of attempting to characterize a substance, a chemist makes the following observations: (a) The substance is a sil
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What is the mass of an atom with seven protons, seven neutrons, and eight electrons?
    13·1 answer
  • How much work does a gas do when it expands against a constant pressure of 0.600 atm from a volume of 50.00 mL to a volume of 44
    6·1 answer
  • Magnesium (24.30g) reacts with hydrogen chloride (xg) to produce hydrogen gas(2.04g) and magnesium chloride (96.90g). How much h
    12·2 answers
  • What is the name of this compound?<br><br> C6H6-<br> C=O-<br> H
    11·2 answers
  • Which of the following is a limitation of Bohr's model?
    14·1 answer
  • Atoms that satisfy the octet rule are said to be __________.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!