1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
polet [3.4K]
3 years ago
13

Balance the chemical equations. 1FeCl3 + KOH → Fe(OH)3 + KC1

Chemistry
1 answer:
wariber [46]3 years ago
3 0

Answer:

FeCl3 + 3KOH → Fe(OH)3 + 3KCl

Explanation:

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
In the Minnesota Department of Health set a health risk limit for acetone in groundwater of 60.0 μg/L . Suppose an analytical ch
siniylev [52]

Answer:

m = 4.7 μg

Explanation:

Given data:

density of acetone = 60.0  μg/L

Volume = 79.0 mL

Mass = ?

Solution:

Formula:

d = m/v

v = 79.0 mL × 1L /1000 mL

v = 0.079 L

Now we will put the values on formula:

d = m/v

60.0  μg/L = m/0.079 L

m = 60.0 μg/L × 0.079 L

m = 4.7 μg

So health risk limit for acetone = 4.7  μg

3 0
2 years ago
Minerals are very useful to us. Which of the following is a false statement? Question options: Pyrite is an ore of gold and is u
lilavasa [31]

Answer:

The false statement is :

  • Pyrite is an ore of gold and is used in jewelry making.
  • Cobalt is not used in medicine.

Explanation:

Pyrite is an ore of iron sulfide found on the Earth and in coal, limestone and in many deposits of metallic ores. Due to its luster and pale yellowish color it appears as gold due to which it is also termed as Fool's gold.

It is used in firearms , in production of sulfur dioxide gas, etc.

Cobalt is used as medicine to treat cancer patient. Co-60 is used in treatment of cancer in which gamma rays produced by Co-60 are used  to kill tumor cells in a cancer patient.

Where as talc is used in industries like : paper making, food, paints, plastics etc. Quartz is primary material used to prepare glass and cobalt is used as

4 0
3 years ago
A scientist found a new species in a rain forest. The species was small and green in color. She examined one of its many cells a
Serhud [2]
It's probably animal if that's what's you're asking.
7 0
3 years ago
Read 2 more answers
Give the number of significant figures indicated 6.695
Genrish500 [490]
3 significant figures 

5 0
3 years ago
Read 2 more answers
Other questions:
  • To 100.0 g water at 25.00 ºc in a well-insulated container is added a block of aluminum initially at 100.0 ºc. the temperature o
    9·1 answer
  • Choose the correct answers from the drop-down menus to complete the paragraph about how sunlight travels through the atmosphere.
    9·2 answers
  • What is the difference between a chemical process and a physical process in chemistry?
    12·1 answer
  • Please help don't know how to do
    10·1 answer
  • What is the change in electrons for nitrogen in the following reaction?
    11·2 answers
  • What is the kinetic energy of a 150 kg object that is moving with a speed of 15 m/s
    13·2 answers
  • 0.15 grams of Mg is combined with HCl to
    13·1 answer
  • Which sphere forms Earth's outermost layer?
    13·1 answer
  • How many grams are in 0.787 moles of kcn
    12·1 answer
  • PLEASE help i will give brainly if someone answers A pleeease help it will help me answer my other questions
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!