1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zvonat [6]
2 years ago
8

_____________ are scientists who study the specific properties of any given potential toxin

Chemistry
1 answer:
dimaraw [331]2 years ago
6 0
Toxicologist.. trained to learn and explore a toxins ingredients or chem. reaction.
You might be interested in
Determine the number of moles of Mn and the number of moles of X in compound A. Clearly distinguish which is which in your calcu
KiRa [710]

Answer:

the to the same to you nd your family members for the same reason the same reason the same

5 0
2 years ago
Which of the following statements does not accurately describe Precambrian Earth?
Ilya [14]

c. the ocean water was salty and rich in dissolved oxygen

3 0
3 years ago
Read 2 more answers
Which metal is most likely to be formed easily into
Nataly [62]

Answer:

answer is gold

Explanation:

bcz gold is having a property of malleable so it can be drawn into thin sheets

5 0
3 years ago
Read 2 more answers
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
What is the relatioship between atomic numbers and ionic radii of the elements in Group 1? what is the relationship between atom
Sever21 [200]
As atomic number increases atomic radii also increase down group 1. ionisation energy down group 1 will also decrease because as atomic radii gets bigger there is less electrostatic force between nuclei and electrons so less energy needed to remove valence electron.
6 0
3 years ago
Other questions:
  • Given this equation: 2P2O5 + 6H2O ---&gt; 4H3PO4.
    14·1 answer
  • Which planet is sometimes called Uranus’s twin? Saturn Pluto Jupiter Neptune
    10·2 answers
  • Que tipo de uniones existen EN QUIMICA?
    14·1 answer
  • What does water taste of? Don't say nothing everything has a taste!
    8·2 answers
  • Într-un amestec de „x” molecule de hidroxid de amoniu NH4OH și 7 molecule de apă se găsesc 39 atomi de hidrogen. Valoarea lui „x
    5·1 answer
  • What is the molarity of 4 mol of naoh dissolved in 2 l of water?
    15·2 answers
  • Question 2 (1.5 points)
    10·1 answer
  • Noble gases such as neon, argon, and krypton do not behave like regular main group elements. They do not like to give up or acce
    7·1 answer
  • Please help with this
    15·1 answer
  • What is a function of the backbone in animals?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!