1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksian1 [2.3K]
3 years ago
6

What is the purpose of strawberry seeds

Chemistry
1 answer:
Butoxors [25]3 years ago
7 0

Answer:

To help spread seeds to make more strawberries. Once a person bites into a strawberry some of the seeds fall and help plant new ones.

Explanation:

Hope this helps:)

You might be interested in
Which of the following would result in butyl phenyl ether as the major product? a. Reaction of phenoxide with 1-bromobutane b. R
AlladinOne [14]

Answer:

Reaction of 1-butanol with bromobenzene

Explanation:

The reaction would yield ether as the major product is the reaction of the 1-butanol with bromobenzene. This is because the reaction does not have the large percentage of the undesired side product. In fact, the major product is about 85 % in composition, compared to the 15 % of the minor product. Hence, the reaction is efficient.

4 0
3 years ago
Energy can be .................. From one form to another................. Can be burned to make heat or electricity.
nataly862011 [7]

Answer:

transferred

Energy

Explanation:

Energy is the ability to change the state of bringing about a work leading to movement or generating electromagnetic radiation. There are actually many forms of energy. So, kinetic energy is a form of energy related to the movement of a body. The combustion, in turn, retrieves the potential energy chemical contained in fuels. Solar panels capture light energy to transform it into electrical energy.

3 0
3 years ago
Find an element that has the same
navik [9.2K]

Answer:sodium

Explanation: because its not hard to look on the PERIODIC TABLE

4 0
3 years ago
Atomic mass number of first 30 elements
dangina [55]

Answer:

Element Atomic Number Atomic Mass

Nickel          27                          58.6934

Cobalt             28                   58.9332

Copper            29                  63.546

Zinc                   30                            65.39

Explanation:

4 0
3 years ago
For the equilibrium
Mamont248 [21]

Answer:

Equilibrium concentrations of the gases are

H_2S=0.596M

H_2=0.004 M

S_2=0.002 M

Explanation:

We are given that  for the equilibrium

2H_2S\rightleftharpoons 2H_2(g)+S_2(g)

k_c=9.0\times 10^{-8}

Temperature, T=700^{\circ}C

Initial concentration of

H_2S=0.30M

H_2=0.30 M

S_2=0.150 M

We have to find the equilibrium concentration of gases.

After certain time

2x number of moles  of reactant reduced and form product

Concentration of

H_2S=0.30+2x

H_2=0.30-2x

S_2=0.150-x

At equilibrium

Equilibrium constant

K_c=\frac{product}{Reactant}=\frac{[H_2]^2[S_2]}{[H_2S]^2}

Substitute the values

9\times 10^{-8}=\frac{(0.30-2x)^2(0.150-x)}{(0.30+2x)^2}

9\times 10^{-8}=\frac{(0.30-2x)^2(0.150-x)}{(0.30+2x)^2}

9\times 10^{-8}=\frac{(0.30-2x)^2(0.150-x)}{(0.30+2x)^2}

By solving we get

x\approx 0.148

Now, equilibrium concentration  of gases

H_2S=0.30+2(0.148)=0.596M

H_2=0.30-2(0.148)=0.004 M

S_2=0.150-0.148=0.002 M

3 0
3 years ago
Other questions:
  • What type of energy is radiometer
    9·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which two metalloids have the same number of electrons shells as iodine? A. boron and silicon B. antimony and tellurium C. germa
    7·2 answers
  • A concrete barrier in a parking lot a structure of mass, frame, or shell? Which one would it be?
    14·1 answer
  • How many grams of Na2SO4 are required to make 0.30 L of 0.500 M Na2SO4?
    14·1 answer
  • Is liquid ice-cream batter a solid, liquid, or gas?
    9·1 answer
  • 2 K + Cl2 → 2 KCI what type of chemical reaction is this
    9·2 answers
  • Hurry I need the answer asap
    11·1 answer
  • I need help again...
    7·2 answers
  • Define each of the following wave phenomena, and give an example of where each occurs: (a) refraction;
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!