1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
grin007 [14]
3 years ago
8

Write the electron configuration for each atom A. Carbon B. Argon C. Nickel

Chemistry
1 answer:
gayaneshka [121]3 years ago
5 0
I will assume you know how to do electron configurations, since they can be hard to explain.
Carbon is the 6th element: it goes 
You might be interested in
Write some example of misicible and immisicible liquid​
Eduardwww [97]

Explanation:

miscible liquids: water and alcohol

immiscible liquids: water and oil

4 0
3 years ago
What is the role of our company compliance Department
kenny6666 [7]
<h3>A compliance department identifies risks that an organization faces and advises on how to avoid or address them.It implements controls to protect the organization from those risks.</h3>

Hope This Answer Helps.

6 0
2 years ago
Explain why mixing two, or more, substances is a physical change.
Strike441 [17]
<span>When two or more substances are mixed together but not chemically joined they are called as mixtures. Therefore, it is only a physical change taking place.
</span>
I hope this helps you! Good luck :)
4 0
3 years ago
Number of atoms in calcium carbonate
lakkis [162]

Answer:

5 Atoms

Explanation

We have one atom of Calcium, One Atom of Carbon and three of Oxygen

3 0
3 years ago
If you are planning a road trip from Orlando Florida to Miami Florida which of the following units would be best to measure the
docker41 [41]
Miles if that is one of the options
8 0
3 years ago
Other questions:
  • Logan is cooking, and he wants to increase the boiling point of the water. Which solute would not be a good choice as it would n
    5·1 answer
  • Hydrochloric acid reacts with calcium to form hydrogen and calcium chloride. If 100 grams of hydrochloric acid reacts with 100 g
    10·2 answers
  • Calculate the kinetic energy of co2 at 254 k .
    12·1 answer
  • How are energy storage molecules affected if there is LESS carbon dioxide?
    7·1 answer
  • Classify the following atom as excited, ground state, or not possible.<br><br> 1s^2 2s^2 2p^6 3p^1
    10·1 answer
  • Which molecule has weakest bond?
    13·1 answer
  • A fertilized egg cell develops into a(n) _________
    10·1 answer
  • Calculate the pOH of this solution. pH = 1.90 pOH =
    14·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • What is the mass number of an atom that contains<br><br> 47 protons, 47 electrons, and 62 neutrons?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!