1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svet-max [94.6K]
3 years ago
8

Which of the following best describes earth tectonic plates ?

Chemistry
2 answers:
saw5 [17]3 years ago
8 0
Im pretty sure the answer is B.
meriva3 years ago
6 0

Answer:

B They move because of the convection currents in the mantle.

You might be interested in
3. Which element is most important for growing crops?
madreJ [45]

Answer:

B. hydrogen

Explanation:

that's because hydrogen is an element.

8 0
3 years ago
a gas that exerts a pressure of 215 torr in a container with a volume of 51.0 mL will exert a pressure of ? torr when transferre
zhannawk [14.2K]
To calculate the new pressure, we can use Boyle’s law to relate these two scenarios (Boyle’s law is used because the temperature is assumed to remain constant). Boyle’s law is:

P1V1 = P2V2,

Where “P” is pressure and “V” is volume. The pressure and volume of the first scenario is 215 torr and 51 mL, respectively, and the second scenario has a volume of 18.5 L (18,500 mL) and the unknown pressure - let’s call that “x”. Plugging these into the equation:

(215 torr)(51 mL) =(“x” torr)(18,500 mL)
x = 0.593 torr

The final pressure exerted by the gas would be 0.593 torr.

Hope this helps!
3 0
4 years ago
Where does acid rain occur?
vlabodo [156]
<span>Acid rain is precipitation that contains high levels of nitric or sulfuric acid. Natural and industrial sources can release sulfur dioxide and nitrogen oxide into the atmosphere, leading them to combine chemically with oxygen and water to form their respective acidic molecules. These acids are then deposited through rain or dust depending on the climate of the region. While acid rain can occur anywhere in the world, it is prevalent in regions that have high industrial activity.</span>
5 0
4 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
A flashlight battery is an example of a
kompoz [17]
<span>Dry cell battery

When an automotive battery is fully charged, the sulfuric acid and water mixture will have a specific gravity of about 1.3. Specific gravity is actually the difference in the weight of water in comparison to a specific fluid. It is measured by a hydrometer. The amount of charge in the battery is normally measured by the specific gravity of the battery. The specific gravity of water is 1 and anything less than one is considered less dense while anything that has a specific gravity of more than 1 is considered more dense than water. </span>
7 0
3 years ago
Other questions:
  • Why is the structure of a molecule important to its function
    11·1 answer
  • Which of the following air fronts does not move?
    15·1 answer
  • Baking soda is also known as sodium hydrogen
    12·1 answer
  • Which of the following equations is NOT balanced properly? Which of the following equations is NOT balanced properly? Cr2(SO4)3
    10·1 answer
  • Xander claims that since the model of the atom has been changed so many times, that means it is a weak model. Willow claims that
    8·1 answer
  • Please Help thank you
    14·1 answer
  • What is Carbonate ion?
    11·2 answers
  • You place air in a sealed can at standard temperature and pressure (STP). You double its absolute temperature (K) while leaving
    11·1 answer
  • Calculate the molar mass of hydrogen phosphate
    14·1 answer
  • Question 1 (Multiple Choice Worth 2 points)
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!