1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NARA [144]
3 years ago
15

True or False Matter is the ability to do work or cause change.

Chemistry
2 answers:
wel3 years ago
8 0

<u>False</u> is the correct answer.

timurjin [86]3 years ago
8 0

Answer:

False

Explanation:

It is Energy that has the ability to cause change.

You might be interested in
5. What happens to the mass when you change<br> the volume?<br> It decreases
anastassius [24]

Explanation:If the mass of the object stays the same but the volume of the object decreases then its density becomes greater. If the volume of the object stays the same but the mass of the object increases then its density becomes greater.

7 0
3 years ago
a child runs 60m race with an average speed of 4 m/s.how long did the child take to complete the race? give the correct unit for
Elis [28]

Answer:

option c. i took the quiz

Explanation:

8 0
3 years ago
ANSWER QUICK PLEASE <br> WORTH 100 POINTS
sukhopar [10]

Answer:

Explanation:

Volume is defined as the space occupied by an object or substance irrespective of its state of matter.The conversion used from millimeter to liter is:

1 milliiliter = 0.001 L

Therefore, we can convert the volume of sample from 2.5 ml in liters as follows.

2.5 ml in liters = 2.5ml x 0.001 L/1ml

= 0.0025 L

Thus, we can conclude that the volume of given sample in liter is 0.0025 L

Hope this helps! :)

6 0
3 years ago
In Part B the given conditions were 1.00 mol of argon in a 0.500-L container at 18.0°C. You identified that the ideal pressure (
Natasha2012 [34]

Answer:

4,38%

small molecular volumes

Decrease

Explanation:

The percent difference between the ideal and real gas is:

(47,8atm - 45,7 atm) / 47,8 atm × 100 = 4,39% ≈ <em>4,38%</em>

This difference is considered significant, and is best explained because argon atoms have relatively <em>small molecular volumes. </em>That produce an increasing in intermolecular forces deviating the system of ideal gas behavior.

Therefore, an increasing in volume will produce an ideal gas behavior. Thus:

If the volume of the container were increased to 2.00 L, you would expect the percent difference between the ideal and real gas to <em>decrease</em>

<em />

I hope it helps!

5 0
3 years ago
What type of scientific inquiry is friction ridge analysis
Ilia_Sergeevich [38]

Answer:

Towards this goal, this project aims to develop a statistical measure of the uncertainty of the decisions made on the friction ridge evidence (i.e., evidential value of fingerprint comparison), which ultimately can be referred to as a scientific basis of the identification decisions made in friction ridge analysis.

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Calculate the value of D at 575°C for the diffusion of some species in a metal for which the values of D0 and Qd are 4.5 × 10-5
    14·1 answer
  • A solution containing potassium bromide is mixed with one containing lead acetate to form a solution that is 0.013 M in KBr and
    12·1 answer
  • How is the density of an object in kg/L related to its density in g/mL? (1 point)​
    8·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which data table below correctly describes the parts of an atom?
    9·1 answer
  • Give me Investigating questions that have dependent variable independent variable and control variable
    7·1 answer
  • Generally, does the size of a radioactive sample affect half-life?
    8·2 answers
  • Can someone list these in correct order? from least brigehst to brightest?​
    12·1 answer
  • A student combines a clear, dark blue solution with a clear, colorless solution and agitates the test tube. The combination resu
    14·1 answer
  • If you blank water it turns into<br> Blank to form gas.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!