1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irakobra [83]
4 years ago
8

Which statement explains why carbon dioxide (CO2) is a gas at room temperature? A. There are constant interactions between the C

O2 molecules. B. There are weak interactions between the CO2 molecules. C. There are no interactions between the CO2 molecules. D. There are strong interactions between the CO2 molecules.
Chemistry
1 answer:
Nezavi [6.7K]4 years ago
6 0

Answer:

B) There are weak interactions between the CO2 molecules.

Explanation:

Carbon dioxide is composed of one carbon atom that is structured between two atoms of oxygen, they are bonded with double bond and the CO2 is symmetrical because of the arrangement of the bond between them.It is less electronegative than Oxgen, this gives Oxgen the ability to attract the electron to themselves, and there is no intermolecular existing within carbon dioxide other bands waal forces.Compounds that are gases under the condition of room temperatures, and pressure usually have have small molecules. and their molecules is usually have van der Waals forces acting between them and theses forces are weak.This allows carbon dioxide molecules to be able to move freely as a gas.

You might be interested in
Complete the sentences to explain what’s happening at different portions of the heating curve.
Neporo4naja [7]

Particles of the substance have the most kinetic energy when the substance is(a)1. A gas. The part of the graph that represents where the substance has the least amount of potential energy is labeled(b)1. Solid.

Gas molecules have the highest average velocities among the three states of matter so gas has the highest kinetic energy. During freezing, a substance loses a lot of potential energy so solid has the least potential energy.

9 0
3 years ago
Read 2 more answers
What is the amount of moles for 12.0 g Ar?
Digiron [165]

if i am correct it shall be 12. because i am thinking, 1 mole = 1 ar.

8 0
3 years ago
Read 2 more answers
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
*GIVING BRAINLIEST* NEED ANSWER ASAPPP
poizon [28]

Same Question here answered by me with explanation check the link below for your answer.

brainly.com/question/24944271?

8 0
3 years ago
Which element would you expect to have properties similar to Chlorine (Cl)
jeyben [28]

Answer:

Iodine

Explanation:

It's in the same group as chlorine.

5 0
3 years ago
Other questions:
  • A sample of a hydrocarbon contains 20.75 g C and 4.25 g H. Its molar mass is 58.04 g/mol. What is its empirical formula C2H5 CH2
    8·2 answers
  • The reaction of 11.9 g of chcl3 with excess chlorine produced 11.2 g of ccl4, carbon tetrachloride: what is the percent yield?
    8·2 answers
  • By making your decision, did you support the opinions of the mayor and/or the dam safety official? why or why not?
    9·1 answer
  • When sodium chloride reacts with iron it forms sodium and iron (ll) Chloride. Write down the balanced equation and classify it \
    15·1 answer
  • What type of boundary exists around the Pacific Ocean?
    14·1 answer
  • Which of the following correctly represents the transmutation in which a curium-242 nucleus is bombarded with an alpha particle
    5·1 answer
  • A diagram used to show inheritance patterns and to predict the genotypes of offspring
    15·1 answer
  • How do we determine the central atom in a chemical bond? How information is need to determine the shape that results in the bond
    11·1 answer
  • LLLLLLLLLLLLLLLLLLLL
    6·1 answer
  • Which statement best describes the Sun-Earth-Moon system during a spring
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!