1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lorico [155]
2 years ago
11

What is the difference between the number of electrons in an atom of tin (Sn) and the number of electrons in an atom of oxygen (

O)?
Chemistry
1 answer:
pishuonlain [190]2 years ago
4 0

Answer:

What is the difference between the number of electrons in an atom of Tin (Sn) which has an atomic number of 50, and the number of electrons in an atom of Chlorine (Cl) which has an atomic number of 17. Which statement accurately describes the atoms of a specific element?

Explanation:

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
WHAT DOES THIS SAY AND WHAT THE ANSWER
notka56 [123]

It says

The majority of elements on the periodic table are ______________ (metals, nonmetals, or metalloids).  

The periodic table on the left separates elements into three groups: the metals (green in the table), nonmetals (orange), and metalloids (blue). Most elements are metals.

Apr 18, 2003

4 0
3 years ago
2Al + 3H2SO4 -&gt; Al2(SO4)3 + 3H2How many grams of aluminum sulfate would be formed if 250g H2SO4 completely reacted with alumi
bazaltina [42]

Answer:

290.82g

Explanation:

The equation for the reaction is given below:

2Al + 3H2SO4 -> Al2(SO4)3 + 3H2 now, let us obtain the masses of H2SO4 and Al2(SO4)3 from the balanced equation. This is illustrated below:

Molar Mass of H2SO4 = (2x1) + 32 + (16x4) = 2 + 32 +64 = 98g/mol

Mass of H2SO4 from the balanced equation = 3 x 98 = 294g

Molar Mass of Al2(SO4)3 = (2x27) + 3[32 + (16x4)]

= 54 + 3[32 + 64]

= 54 + 3[96] = 54 + 288 = 342g

Now, we can obtain the mass of aluminium sulphate formed by doing the following:

From the equation above:

294g of H2SO4 produced 342g of Al2(SO4)3.

Therefore, 250g of H2SO4 will produce = (250 x 342)/294 = 290.82g of Al(SO4)3

Therefore, 290.82g of aluminium sulphate (Al(SO4)3) is formed.

7 0
3 years ago
All of the following can increase the rate of chemical reaction EXCEPT:
dangina [55]

Except catalyst because catalyst typically speed up a reaction by reducing the activation energy or changing the reaction mechanism.

5 0
3 years ago
Can an ion be either positive or negative? True or False
vekshin1

Answer:

True

Explanation:

3 0
2 years ago
Other questions:
  • Is Mika souring chemical or physical
    12·1 answer
  • A green laser pointer emits light with a wavelength of 542 nm. What is the frequency of this light?
    15·1 answer
  • An aerosol can contains gases under a pressure of 4.50 atm at 20.0 degrees Celsius. If the can is left on a hot, sandy beach, th
    11·1 answer
  • If you want to stop the the current flow through device 3 in the circuit shown above which one of the following single switches
    15·1 answer
  • Beginning with interphase, use the letters to order the following events:
    6·1 answer
  • Which →two← factors decrease as the kinetic energy of the particles in an object decreases?
    5·2 answers
  • which feature of the ocean floor includes its deeper parts ? A.Trench B.estuary C.mid-ocean D. contnetal slop
    8·1 answer
  • A solution of HCl with a volume of 25.00 mL is titrated to the endpoint, with 0.250 M
    13·1 answer
  • What is the difference in basicity between drain cleaner (pH 13) and ammonia (pH 11.9)?
    7·2 answers
  • A _____ activation energy is required to break the double bonds of unsaturated hydrocarbons. high extreme large low
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!