1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ostrovityanka [42]
2 years ago
15

Plzz giving brainlist to first answer!Plss fill in the blanks!!ASAP.Modeling Our Solar System

Chemistry
1 answer:
Gwar [14]2 years ago
3 0

Answer:

The planets follow these orbit  paths as they travel around the Sun. The Sun’s gravity  

makes the planets move in this way. It pulls on the planets, keeping them in motion in their orbit.

Modeling is a way to see ideas or have a  particular idea or

concept.

 Models do have some lines .

 Often a model is made with certain things.

 A model of the solar system may contain all of the planets and the Sun, but it may not include the planets’

individual moons or every planit  and rock in the solar system.

Explanation: if you think about it and and look at pics it is easy

hope this helps

You might be interested in
Help this is due in 5 minutes
Fed [463]

Answer:

no

Explanation:

they avoid most fur and bones because hawks and eagles rip them apart to get the flesh and owls swallow bones and fur too

6 0
2 years ago
Read 2 more answers
When two hydrogen atoms bond with one oxygen Atom to form water what happens to the electrons
Likurg_2 [28]
<span>Most bonds are made when a positive atom or molecule (one that is missing an electron in its outer shell) accepts an electron from a negative atom or molecule. Hydrogen is a positive ion because it only has one electron in its outer shell instead of a pair. Oxygen has paired electrons, but because it is highly electronegative one of the outer electrons is held closer to the nucleus, creating a partial negative charge. This partial negative charge attracts the electron in the outer shell of hydrogen and creates a bond. This type of bond accounts for the high surface tension in water.</span>
5 0
3 years ago
What is the enthalpy for reaction 1 reversed?reaction 1 reversed: N2O4→N2 + 2O2
Nutka1998 [239]

Answer:

8kJ/mol

Explanation:

since the forward reaction is -8kJ/mol, the backward reaction has the same enthalphy but reversed

7 0
2 years ago
How many grams are there in 4057.53 pounds. HELP PLZ NEED ANSWER ASAP SHOW WORK PLZ HELP
JulijaS [17]

Answer:

plz plz plz mark as brainlest

Explanation:

4057.53 pounds =

1840464.65 grams

5 0
3 years ago
Replication, Transcription, and Translation Chart
NemiM [27]

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

6 0
2 years ago
Other questions:
  • 0.0145 moles of helium gas are introduced into a balloon so that the volume of the balloon is 2.54 liters. An additional amount
    15·1 answer
  • Did I get the answer correct, and could someone possibly explain?
    14·1 answer
  • What are some physical characteristics of the Sun?
    14·1 answer
  • What is the name of the salt with the structure K2S
    14·1 answer
  • lassify these bonds as ionic, polar covalent, or nonpolar covalent. Ionic Polar covalent Nonpolar covalent
    11·1 answer
  • How do u find ratios of unknown value
    11·1 answer
  • i don't need these solved I just need the steps to solve it and. what these problems in chemistry would be called so I can look
    8·1 answer
  • 150 words describing Bohr’s model, and the fundamental principles behind it. Also, explain how Bohr’s model is different from Ru
    8·1 answer
  • Please hurry!!! And help!!
    6·2 answers
  • What is the significance of the Roman Numeral when naming binary ionic compounds?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!