1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
4 years ago
14

This aquifer supplies one-third of the irrigation water in the United States

Biology
1 answer:
N76 [4]4 years ago
8 0

<u>ANSWER:</u>

Ogallala aquifer supplies "one-third of the irrigation water" in the United States.

<u>EXPLANATION:</u>

  • The "Ogallala aquifer" is located in the "Great Plains of the United States" and therefore gives life to almost all fields of the US.
  • The aquifer supplies water for one-third irrigation needs of the United States. The Ogallala is an underground reservoir and is very big in size and the agriculture production in the US is dependent on this aquifer.
  • The aquifer is however depleting and water level in many areas has become very low.
  • It is important for United States to protect and preserve this aquifer so that the agricultural production does not suffer.
You might be interested in
The teeth of grain-eating animals (such as horses) are usually broad and ridged. This makes the teeth suitable for grinding and
AysviL [449]

Answer:

This illustrates a result of natural selection pressure on them and the connection between form and function.

Explanation:

It is due to natural selection and adaption of species which allow the broad and ridged teeth for grain-eating animals like in horses and pointed teeth for flesh-eating animals.  

This natural selection and adaptation of species allow them to fit in their environment and survive. Natural selection favored the favorable traits which became more common over time in these organisms and allow their teeth to gain specific structure which perform a specific function. So their teeth form is structured according to the function they perform.

8 0
3 years ago
When double-stranded dna is heated to 95°c, the bonds between complementary base pairs break to produce single-stranded dna. con
Delicious77 [7]
Single-stranded DNA<span> is produced during all aspects of </span>DNA<span> metabolism: replication, recombination, and repair. </span><span>No. A continuous input of energy is required. Chemical reactions are spontaneous if they can proceed on their own, without any continuous external influence such as added energy (in this case heat).</span>
7 0
3 years ago
The ___ head of the phospholipids can interact with the internal enviorment of the cell
Iteru [2.4K]
Phosphate head (hydrophilic)
6 0
3 years ago
Why is it important for the hydrophobic part of the plasma membrane to be sandwiched by the hydrophilic parts?
Alona [7]

Answer:

It is important that the phospholipid bilayer is both hydrophobic in the surface and hydrophilic inside to control and manage the incoming organic compounds mainly water from exceeding the needed amount or destablizing the concentration established by the cells.

4 0
3 years ago
According to cell theory,which of the following best describes the role of cells in living organisms? A.cells join together to f
Ivanshal [37]
B: Cells are the basic operating units of living organisms.
6 0
4 years ago
Read 2 more answers
Other questions:
  • Scenario 2: Make a cross between the following flies: 1: A heterozygous gray-bodied fly and 2: A heterozygous gray-bodied fly. W
    13·1 answer
  • What does the term carrying capacity refer to?
    12·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • The amazing success of science are because scientists have followed the rules of science true or false?
    11·2 answers
  • At which temperature does the motion of atoms and molecules stop?
    10·2 answers
  • Un paciente que tiene la temperatura corporal en 38,6 c°, ¿qué necesidad alterada tiene? Oxigenación. Homotermia. Circulación. E
    8·1 answer
  • Why is it important to understand the causes and possible locations of earthquakes?
    14·1 answer
  • . What is the process called when the food coloring moved into the egg placed in acid?
    10·1 answer
  • What are the components of blood<br>​
    6·2 answers
  • Moon
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!