1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
beks73 [17]
3 years ago
5

What was used to fill thermometers before mercury? magma bourbon brandy helium

Chemistry
1 answer:
Tasya [4]3 years ago
4 0

Answer:brandy was used to tell the temperature.May 7, 2013

Explanation:

Before mercury, what was used to fill thermometers? Was it Hawaiian Punch, well no silly. Long before mercury filled thermometers, brandy was used to tell the temperature.May 7, 2013

You might be interested in
A class of substances known as __________ are used for their medicinal properties.
Misha Larkins [42]

Answer: Alkaloids

A class of substances known as alkaloids are used for their medicinal properties.

Explanation:

Alkaloids are small but complex organic substances with at least one nitrogen atom in its ring structure. Hence, they have strong basic properties, and are produced in naturally by some plants.

Examples of alkaloids and their medicinal properties are as follows:

- caffeine, used in certain drug and drinks to stimulate the nervous system

- morphine, used to reduce pain and induce sleep in humans.

- cocaine, nicotine etc

6 0
3 years ago
Read 2 more answers
A compound with a molar mass of 60g/mol is 40.4% carbon, 6.7% hydrogen and 53.3% oxygen (by mass). determine the emperical and m
Fittoniya [83]

<span>A compound is found to be 40.0% carbon, 6.7% hydrogen and 53.5% oxygen. Its molecular mass is 60. g/mol. 
</span>Q1)
Empirical formula is the simplest ratio of whole numbers of components making up a compound.
the percentages have been given, therefore we can calculate for 100 g of the compound.

                                C                            H                        O
Mass in 100 g      40.0 g                       6.7 g                   53.5 g
Molar mass            12 g/mol                1 g/mol                 16 g/mol
Number of moles   40.0/12= 3.33         6.7/1 = 6.7          53.5/16 = 3.34
Divide by the least number of moles  
                             3.33/3.33 = 1           6.7/3.33 = 2.01   3.34/3.33 = 1.00
after rounding off
C - 1 
H - 2
O - 1

Empirical formula - CH₂O

Q2)
Molecular formula is the actual number of components making up the compound.
To find the number of empirical units we have to find the mass of one empirical unit.
Mass of one empirical unit = CH₂O - 12 + (1x2) + 16 = 30 g
Mass of one mole of compound = 60 g
Number of empirical units = 60 g / 30 g = 2
Therefore molecular formula - 2(CH₂O) 
 Molecular formula - C₂H₄O₂
4 0
3 years ago
And I living organism what is a tissue
Leviafan [203]
It is an ensemble of similar cells
4 0
2 years ago
Read 2 more answers
How many protons does gold have
shusha [124]

Answer:

gold has 79 protons

Explanation:

i looked it up lol

8 0
3 years ago
An Earth-like planet is 500 light years away why is this an Obstacle for a manned Space mission?
maxonik [38]

Answer:c the correct technology cannot support this mission

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • The first question is the one I need help with
    10·1 answer
  • Which of these choices best describes the interpretation of the following peak that may be recorded in a 1H NMR spectrum?
    8·1 answer
  • As we grow older.
    14·2 answers
  • The Haber Process is the main industrial procedure to produce ammonia. The reaction combines nitrogen from air with hydrogen mai
    8·1 answer
  • PLEASE HELP ME WITH THESE TWO QUESTIONS!!MY CHEMISTRY QUIZ IS DUE AT MIDNIGHT:(
    13·1 answer
  • "An aqueous CaCl2 solution has a vapor pressure of 83.1mmHg at 50 ∘C. The vapor pressure of pure water at this temperature is 92
    14·1 answer
  • If sodium (Na) bonds with chlorine (Cl), which statement is true?
    12·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which ion dissociates in Acids?<br><br> A- ООН-<br> B- ОН+<br> C- ОН+<br> D- COOH
    11·1 answer
  • When the ventricles contract, blood is pumped
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!