1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Archy [21]
2 years ago
7

A sample of propane(c3h8)has 3.84x10^24 H atoms.

Chemistry
1 answer:
deff fn [24]2 years ago
8 0

Answer:

A) 14. 25 × 10²³ Carbon atoms

B) 34.72 grams

Explanation:

1 molecule of Propane has 3 atoms of Carbon and 8 atoms of Hydrogen.

The sample has 3.84 × 10²⁴ H atoms.

If 8 atoms of Hydrogrn are present in 1 molecule of propane.

3.84 × 10²⁴ H atoms are present in

\mathfrak{ \frac{3.8 }{8} \times 10 ^{24}}

<u>= 4.75 × 10²³ molecules of Propane</u>.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

No. of Carbon atoms in 1 molecule of propane = 3

=> C atoms in 4.75× 10²³ molecules of Propane = 3 × 4.75 × 10²³

<u>= 14.25 × 10²³ </u>

<u>________________________________________</u>

<u>Gram</u><u> </u><u>Molecular</u><u> </u><u>Mass</u><u> </u><u>of</u><u> </u><u>Propane</u><u>(</u><u>C3H8</u><u>)</u>

= 3 × 12 + 8 × 1

= 36 + 8

= 44 g

1 mole of propane weighs 44g and has 6.02× 10²³ molecules of Propane.

=> 6.02 × 10²³ molecules of Propane weigh = 44 g

=> 4. 75 × 10²³ molecules of Propane weigh =

\mathsf{ \frac{44 }{6.02 \times  {10}^{23} } \times 4.75 \times  {10}^{23}  }

\mathsf{  = \frac{44 }{6.02 \times   \cancel{{10}^{23} }} \times 4.75 \times \cancel{ {10}^{23}}  }

\mathsf{  = \frac{44 }{6.02 } \times 4.75   }

<u>= 34.72 g</u>

You might be interested in
If an experiment calls for 0.200mole acetic acid (Hc2H3O2)how many grams of glacial acetic acid do we need?
bija089 [108]
<h3>Molar mass:-</h3>

\\ \sf\longmapsto HC_2H_3O_2

\\ \sf\longmapsto 1u+2(12u)+3(1u)+2(16u)

\\ \sf\longmapsto 1u+24u+3u+48u

\\ \sf\longmapsto 28u+48u

\\ \sf\longmapsto 76u

\\ \sf\longmapsto 76g/mol

  • No of moles=0.2mol
  • Given mass=?

\\ \sf\longmapsto No\:of\;moles=\dfrac{Given\:Mass}{Molar\:Mass}

\\ \sf\longmapsto 0.2=\dfrac{Given\:mass}{76}

\\ \sf\longmapsto Given\:Mass=0.2\times 76

\\ \sf\longmapsto Given\:Mass=1.52g

7 0
3 years ago
Morphine is a well known pain killer but is highly addictive. The lethal dose of morphine varies from person to person based on
Aliun [14]

Answer:

0.252 milimoles

Explanation:

To convert mass of a substance to moles it is necessary to use the molar mass of the substance.

The formula of morphine is C₁₇H₁₉NO₃, thus, its molar mass is:

C: 17*12.01g/mol = 204.17g/mol

H: 19*1.01g/mol = 19.19g/mol

N: 1*14g/mol = 14g/mol

O: 3*16g/mol = 48g/mol.

204.17 + 19.19 + 14 + 16 = <em>285.36g/mol</em>

Thus, moles of 71.891 mg = 0.071891g:

0.071891g × (1mol / 285.36g) = 2.5193x10⁻⁴ moles

As 1 mole = 1000 milimoles:

2.5193x10⁻⁴ moles = <em>0.252 milimoles</em>

7 0
3 years ago
9
marishachu [46]

Answer:

B. as a food preservative in the manufacture of detergents

.........

8 0
3 years ago
Enter a range of values for x, 2x+10, 14 ​
PIT_PIT [208]

Answer:

62 degrees and 15.

Explanation:

3 0
3 years ago
A certain compound is made up of one phosphorus (P) atom, three chlorine (Cl) atoms, and one oxygen (O) atom. What is the chemic
Karolina [17]
POCl3 is the chemical formula of compound.
3 0
3 years ago
Other questions:
  • How many grams of solid barium sulfate form when 25.0 ml of 0.160 m barium chloride reacts with 68.0 ml of 0.055 m sodium sulfat
    9·1 answer
  • Which of the following is not a fluid 1. Plasma 2. Liquid 3. Gas 4. Plasma
    12·1 answer
  • Ca+HCI—&gt;CaCI2+H2, what is the reaction?
    7·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Number 3 please. I have no hope
    15·1 answer
  • How many elements are on the Periodic Table?
    10·2 answers
  • What is the difference in height between the top surface of the glycerin and the top surface of the alcohol? Suppose that the de
    12·1 answer
  • What days did the Catholic Church h celebrate with fireworks
    7·2 answers
  • How much total energy must be absorbed by a 150 g sample of ice at 0.0°C that it melts
    6·1 answer
  • Sub-atomic particles like negatively charged electrons, positively charged
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!