1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OleMash [197]
3 years ago
8

Has the research described in this article been peer reviewed?

Chemistry
1 answer:
Igoryamba3 years ago
5 0

Answer:

answer it correctly!!

dapat kase iniintidi ang pag basa , dahil kong hindi mo ito aayosin pag basa wapa kang ma totonan

You might be interested in
The atomic mass of titanium is 47.88 atomic mass units. This atomic mass represents the
kkurt [141]
Answer (3) is the most correct, although (2) is not to be ignored. (3) states the most abundant isotope Ti's average mass, which is certainly true. (2) is the total mass of all protons, neutrons, and electrons in an atom of Ti, which is true but has to be more specific in order to pinpoint exactly the 47.88 amu. (4) is incorrect because it is not of all the naturally occurring isotopes of Ti. (1) is incorrect because they forgot electrons.
3 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
When the pressure of a gas doubles, the new volume
s344n2d4d5 [400]

Answer:

yes it does

Explanation:

6 0
3 years ago
Density (D) is defined as the ratio of mass (m) to volume (V) and can be determined from the expression D = . Find the density o
olchik [2.2K]

Explanation:

87.329 g/32.32 cm³ = 2. 70 g/cm³

4 0
2 years ago
Need some facts on the big bang theory! -Science
bearhunter [10]

Answer:

Here you go!

Explanation:

Our Universe is just a small part. There are many other Universes’ that exist. We live in a Multiverse. ...

Astronomer Edwin Hubble, in 1920’s, discovered that the Universe is not static. It is expanding and contracting continuously.

There is a dark energy that is making the Universe expand and accelerate at a larger rate than it did many years ago. ...

The Universe is infinite. It has no end. Thus scientists believe that the Universe is not a closed sphere but as flat as a sheet of paper and has no ...

According to the scientists the planets, stars and galaxies include only 4% of what a Universe consists of. 96% of the things in the Universe cannot be seen.

6 0
2 years ago
Read 2 more answers
Other questions:
  • H3c6h5o7(aq) + 3nahco3(aq) → 3co2(g) + 3h2o(l) + na3c6h5o7(aq) calculate the number of grams of baking soda (nahco3; molar mass
    10·1 answer
  • C5h12 formula mass= molar mass=
    8·1 answer
  • Which ingredients produce the best bar for growth and repair?
    15·1 answer
  • List a couple general characteristics of primary consumers and list a few examples.
    9·2 answers
  • The interaction of the skeletal and muscular systems to create movement and locomotion is regulated by which organ system?
    11·1 answer
  • 4. The only two elements in alkanes, alkenes and alkynes are...
    9·1 answer
  • How many moles in 206.91 g Na
    10·1 answer
  • . Based on their position in the periodic table, predict which (of the two elements given) will be more reactive Circle your cho
    14·1 answer
  • Use Dalton’s theory to explain why potassium nitrate from India or Italy has the same mass percents of K, N, and O.
    13·1 answer
  • Two molecules of mercury oxide decompose into 2 molecules of mercury and 1 molecule of oxygen gas. Which of the following
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!