1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-Dominant- [34]
4 years ago
14

Liquid Q is a polar solvent and liquid R is a nonpolar solvent. On the basis of this information, you would expect:

Chemistry
1 answer:
bearhunter [10]4 years ago
6 0
4) is correct
This is because water is polar and it will mix with a polar solvent. A good rule for remembering the behavior of non-polar and polar compounds when it comes to being miscible is that "like dissolves like."
You might be interested in
Have any of you guys ever got suspended because you made a stink bomb in science class?
AleksAgata [21]

Answer:

No :s

Explanation:

3 0
3 years ago
Read 2 more answers
A sample of gas (24.2 g) initially at 4.00 atm was compressed from 8.00 l to 2.00 l at constant temperature. after the compressi
FinnZ [79.3K]
Answer: 16 atm  
Explanation: 
P1V1 = P2V2 
P2 = P1V1/V2 
=4 atm x 8.00 L/2.00L = 16 atm
5 0
3 years ago
When 21.45 g of KNO3 was dissolved in water in a calorimeter, the temperature fell from 25.00°C to 14.14 °C. If the heat capacit
pashok25 [27]

25.9 kJ/mol. (3 sig. fig. as in the heat capacity.)

<h3>Explanation</h3>

The process:

\text{KNO}_3\;(s) \to \text{KNO}_3\;(aq).

How many moles of this process?

Relative atomic mass from a modern periodic table:

  • K: 39.098;
  • N: 14.007;
  • O: 15.999.

Molar mass of \text{KNO}_3:

M(\text{KNO}_3) = 39.098 + 14.007 + 3\times 15.999 = 101.102\;\text{g}\cdot\text{mol}^{-1}.

Number of moles of the process = Number of moles of \text{KNO}_3 dissolved:

\displaystyle n = \frac{m}{M} = \frac{21.45}{101.102} = 0.212162\;\text{mol}.

What's the enthalpy change of this process?

Q = C\cdot \Delta T = 0.505 \times (25.00 - 14.14) = 5.4843\;\text{kJ} for 0.212162\;\text{mol}. By convention, the enthalpy change \Delta H measures the energy change for each mole of a process.

\displaystyle \Delta H = \frac{Q}{n} = \frac{5.4843\text{kJ}}{0.212162\;\text{mol}} = 25.8\;\text{kJ}\cdot\text{mol}^{-1}.

The heat capacity is the least accurate number in these calculation. It comes with three significant figures. As a result, round the final result to three significant figures. However, make sure you keep at least one additional figure to minimize the risk of rounding errors during the calculation.

4 0
3 years ago
I need help please . science
dlinn [17]

Answer:

Whats that supposed to mean?

whats the question

Explanation:

8 0
3 years ago
Read 2 more answers
¿Qué tipo de Inter conversión existe en una celda galvánica o en una celda electrolítica? a) de energía química a energía eléctr
insens350 [35]

Answer:

Opción a)

Explanation:

En este caso, vamos a explicartelo descartando opciones. Para empezar el proceso que existe en una celda galvánica o electrolítica, es lo que uno llama un proceso de Electroquímica, y permite manipular y usar la energía electrica para generar una reacción.

En este caso, yo tengo por ejemplo una celda galvánica con dos componentes como hierro y cobre conectados mediante una celda. El proceso de reacción entre ellos es lo que ayudará a que se genere energia electrica y esto, encendería un bombillo de luz. También puede ocurrir lo contrario. Con electricidad, se genera una reacción química. En estos casos, se genera una reacción de tipo REDOX (Oxido reducción).

Tomando en cuenta esto, la respuesta correcta sería la opción a). Veamos por que las otras opciones no son:

b) Energía eléctrica a química

Esta opción es falsa, porque estaría supeditando que una reacción solo puede darse por medio de una manipulación de la energía electrica y en las celdas galvánicas no ocurre eso, sino al revés.

c) Energía química a eléctrica

Falsa, porque es igual que la anterior, solo está supeditado a que ocurra este tipo de reacciones y no es así.

d) energía lumínica a eléctrica

Falso porque la energía lumínica proviene tambien de la electricidad, y en el caso de una celda galvánica se genera una reacción por lo que existe otro tipo de energía.

Espero esto te ayude.

7 0
3 years ago
Other questions:
  • What is an energy sublevel
    5·1 answer
  • 4. Will the net force be balanced or unbalanced?<br> 7N<br> 4N<br> A. Balanced<br> B. Unbalanced
    5·1 answer
  • Which elements are represented by the symbols S and Na?
    9·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Imagine two solutions with the same concentration and the same boiling point, but one has benzene as the solvent and the other h
    12·2 answers
  • Which of the following best describes an atom? * the smallest unit of living things only the smallest unit of an element the sma
    5·1 answer
  • What are the formulas for the products of the reaction:
    14·1 answer
  • A sample of hydrogen gas at a pressure of 0.926 atm and a temperature of 29.5 C, occupies a volume of 457 mL. If the gas is allo
    12·1 answer
  • Determine the molecular geometry of SeF4.
    8·1 answer
  • If the density of carbon tetrachloride is 0.893 g/mL, and a sample has a volume of 9.29 mL, what is the mass?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!