1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrMuchimi
3 years ago
8

In what area of the united states do the fewest people live​

Chemistry
2 answers:
PtichkaEL [24]3 years ago
8 0

Answer: Alaska. Alaska is by far the least densely populated of the US states and has 1.3 persons per square mile.

Explanation:

Hope it helped .

fiasKO [112]3 years ago
6 0

Answer:

The most populous state in the United States is California, which has 37,253,956 inhabitants. On the other hand, the least populated state is Wyoming with 493,782 inhabitants.

You might be interested in
A major component of gasoline is octane (C8H18). When octane is burned in air, it chemically reacts with oxygen gas (O2) to prod
Olin [163]

Answer:

The answer is 6.25g.

Explanation:

First create your balanced equation. This will give you the stoich ratios needed to answer the question:

2C8H18 + 25O2 → 16CO2 + 18H2O

Remember, we need to work in terms of NUMBERS, but the question gives us MASS. Therefore the next step is to convert the mass of O2 into moles of O2 by dividing by the molar mass:

7.72 g / 16 g/mol = 0.482 mol

Now we can use the stoich ratio from the equation to determine how many moles of H2O are produced:

x mol H2O / 0.482 mol O2 = 18 H2O / 25 O2

x = 0.347 mol H2O

The question wants the mass of water, so convert moles back into mass by multiplying by the molar mass of water:

0.347 mol x 18 g/mol = 6.25g

8 0
3 years ago
Read 2 more answers
What is the concentration of a potassium iodate solution after you complete the following porcedure? Pipette 10 mL of a 0.31 M p
zubka84 [21]

<u>Given:</u>

Initial concentration of potassium iodate (KIO3) M1 = 0.31 M

Initial volume of KIO3 (stock solution) V1 = 10 ml

Final volume of KIO3 V2 = 100 ml

<u>To determine:</u>

The final concentration of KIO3 i.e. M2

<u>Explanation:</u>

Use the relation-

M1V1 = M2V2

M2 = M1V1/V2 = 0.31 M * 10 ml/100 ml = 0.031 M

Ans: The concentration of KIO3 after dilution is 0.031 M

4 0
2 years ago
Write balanced complete ionic equation for K2SO4(aq)+CaI2(aq)→CaSO4(s)+KI(aq)
tatyana61 [14]
CaSO4(s) might be an improperly capitalized: CAsO4(S), CaSO4(S) Balanced equation: K2SO4(aq) + CaI2(aq) = CaSO4(s) + 2 KI(aq) Reaction type: double replacement.
7 0
3 years ago
Read 2 more answers
9. Ibuprofen contain which of the following two functional groups: (1 point)
stira [4]

Answer:

A and C

I hope this helps you:)

4 0
3 years ago
A + B = C + D + heat
Marrrta [24]
The reaction is an exothermic one because heat is released to the surroundings. An exothermic reaction is a chemical reaction where energy is being released as the reaction by light or heat. On the other hand, endothermic reaction needs energy input for the reaction to proceed.
4 0
2 years ago
Other questions:
  • What is the magnitude of the dipole moment formed by separating a proton and an electron by 85 pm ?
    8·1 answer
  • How many valence electrons does oxygen have? 2 4 6 8 10
    10·2 answers
  • Which 10-milliliter sample of water has the greatest degree of disorder?A)H2O(g) at 120°CB)H2O() at 80°CC)H2O() at 20°CD)H2O(s)
    13·1 answer
  • Which is a Characteristic of a non elecrolyte​
    5·1 answer
  • Determine the number of molecules present in 5.60 mol of nitrogen dioxide, the number of atoms of oxygen, and the number of nitr
    6·1 answer
  • What planets have solid cores?
    9·1 answer
  • HELP! ASAP!!! WILL MARK BRAINLIEST!!
    5·2 answers
  • Please tell me witch one goes with what. It can be continental drift or plate tectonics. please tell me if you need help
    15·2 answers
  • Please someone solve this and tell me how you solve it
    13·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!