1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ExtremeBDS [4]
2 years ago
10

A 100 watt solar power panel usually costs $146 they are on sale for 0.75 of the regular price what is the sale price

Chemistry
1 answer:
gregori [183]2 years ago
8 0
Answer: $109.5
Multiply $146 (original price) by 0.75 (the percentage) and there’s your answer!
You might be interested in
Study the graph about seismic waves.
Salsk061 [2.6K]

Answer:

siezmic waves increase

Explanation:

5 0
3 years ago
Read 2 more answers
Choose the nonmetallic elements from the list. Check all that apply yttrium: oxygen: boron: polonium: argon: gallium: carbon:
BaLLatris [955]

Answer:

B, E, & G

Oxygen, Argon, & Carbon

7 0
3 years ago
Read 2 more answers
Products: 1-methylcyclohexene, 3-methylcyclohexene, methylenecyclohexane
Lostsunrise [7]

Answer:

See explanation

Explanation:

The reaction that we are considering here is quite a knotty reaction. It is difficult to decide if the mechanism is actually E1 or E2 since both are equally probable based on the mass of scientific evidence regarding this reaction. However, we can easily assume that the methylenecyclohexane was formed by an E1 mechanism.

Looking at the products, one could convincingly assert that the reaction leading to the formation of the two main products proceeds via an E1 mechanism with the formation of a carbocation intermediate as has been shown in mechanism attached to this answer. Possible rearrangement of the carbocation yields the 3-methylcyclohexene product.

8 0
3 years ago
You are making lemonade and the calls for 6 cups Lemon juice (L), 3 Cups of sugar (S) and 5 cups of water (W) to make 12 Cups of
vova2212 [387]

Answer:

18 Cups

Submitted the assignment

Explanation:

4 0
2 years ago
: If you know that a ∝ b and a ∝ c, then you can also say that a ∝ bc, or the product of b and c. Take the above three proportio
aleksley [76]

Answer:

V ∝ abc

Explanation:

This task is a joint variation task involving only direct proportionality:

Direct variation is one in which two variables are in direct proportionality to each other. This means that as one increases, the other variable also increases and vice - versa.

Joint variation is one in which one variable is dependent on two or more variables and varies directly as each of them.

In this exercise:

If a ∝ b and a ∝ c, then a ∝ bc

Taking the above three proportionalities,

V ∝ a ∝ b ∝ c

V ∝ a ∝ bc

V ∝ abc

3 0
3 years ago
Other questions:
  • What substance helps suspend fat in a watery digestive mixture, making fat more available to digestive enzymes?
    5·1 answer
  • Suppose the filament in a super-powerful flashlight is heated up to 3600 K. What type of light would be given off by this filame
    13·2 answers
  • Because antigen receptor genes are randomly rearranged, some immature lymphocytes produce receptors specific for epitopes on the
    9·1 answer
  • raw three water molecules interacting with each other. Indicate hydrogen-bonding with dashed lines. Show lone pairs!
    12·1 answer
  • Fog is composed of water droplets in air. Which term describes fog? A. solution B. colloid C. suspention D. solvent
    12·2 answers
  • What is the half-life of a product?
    8·1 answer
  • The pH of an acid substance is between what values on the pH scale? A)0 and 4 B) 0 and 7 C) 7 and 14 D) greater than 14
    12·1 answer
  • Please tell me answers I am given you brainliest ​
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • In which type of radioactive decay does the nucleus become more stable without changing its identity?(1 point)
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!