GGCCATAGGTCCCTTTAGCG
I believe this is correct (I used the complementary base)
Answer: the statements in 1 and 2 are true of IR spectroscopic region.
1. In general, the IR FUNDAMENTAL region has a longer wavelength region than the region we call the ultraviolet (uv) region.
2. We can sense some of the frequencies of the FUNDAMENTAL region of the IR as heat
Explanation:
IR has energy value between 10^-5eV - 10^-2eVwhile
UV has energy value of 4eV - 300eV
IR has low photon energy and cannot alter atoms and molecules while UV has sufficient energy to iodize atoms therefore UV has a higher energy band.
Infrared light falls just outside the visible spectrum, beyond the edge of what we can see as red.
Answer:...intercellular receptors
Explanation:
Lipophilic hormone also known as lipid-soluble hormones can pass through the cell's plasma membrane, to bind to intracellular receptors, so as to effect change in gene expression.
Answer:
E) 2.38
Explanation:
The pH of any solution , helps to determine the acidic strength of the solution ,
i.e. ,
- Lower the value of pH , higher is its acidic strength
and ,
- Higher the value of pH , lower is its acidic strength .
pH is given as the negative log of the concentration of H⁺ ions ,
hence ,
pH = - log H⁺
From the question ,
the concentration of the solution is 0.0042 M , and being it a strong acid , dissociates completely to its respective ions ,
Therefore , the concentration of H⁺ = 0.0042 M .
Hence , using the above equation , the value of pH can be calculated as follows -
pH = - log H⁺
pH = - log ( 0.0042 M )
pH = 2.38 .
