1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kiruha [24]
2 years ago
7

Finish the attachment quick it's due pleaseee

Chemistry
1 answer:
IrinaK [193]2 years ago
6 0

Answer: hello tada

Explanation:

You might be interested in
Please help me, please i really need it :)
Mekhanik [1.2K]

GGCCATAGGTCCCTTTAGCG

I believe this is correct (I used the complementary base)

4 0
3 years ago
What kind of scientist would study how mistletoe harms trees?
posledela

Answer:

Biologist

Explanation:

5 0
4 years ago
Which of the following statements about the ordinary IR spectroscopic regions are TRUE? 1. In general, the IR FUNDAMENTAL region
yaroslaw [1]

Answer: the statements in 1 and 2 are true of IR spectroscopic region.

1. In general, the IR FUNDAMENTAL region has a longer wavelength region than the region we call the ultraviolet (uv) region.

2. We can sense some of the frequencies of the FUNDAMENTAL region of the IR as heat

Explanation:

IR has energy value between 10^-5eV - 10^-2eVwhile

UV has energy value of 4eV - 300eV

IR has low photon energy and cannot alter atoms and molecules while UV has sufficient energy to iodize atoms therefore UV has a higher energy band.

Infrared light falls just outside the visible spectrum, beyond the edge of what we can see as red.

5 0
3 years ago
Lipid-soluble hormones usually bind to __________ receptors.
kumpel [21]

Answer:...intercellular receptors

Explanation:

Lipophilic hormone also known as lipid-soluble hormones can pass through the cell's plasma membrane, to bind to intracellular receptors, so as to effect change in gene expression.

3 0
3 years ago
What is the pH of a 0.0042 M hydrochloric acid solution?
babymother [125]

Answer:

E) 2.38

Explanation:

The pH of any solution , helps to determine the acidic strength of the solution ,

i.e. ,

  • Lower the value of pH , higher is its acidic strength

and ,

  • Higher the value of pH , lower is its acidic strength .

pH is given as the negative log of the concentration of H⁺ ions ,

hence ,

pH = - log H⁺

From the question ,

the concentration of the solution is 0.0042 M , and being it a strong acid , dissociates completely to its respective ions ,

Therefore , the concentration of H⁺ = 0.0042 M .

Hence , using the above equation , the value of pH can be calculated as follows -

pH = - log H⁺

pH = - log ( 0.0042 M )

pH =  2.38 .

4 0
3 years ago
Other questions:
  • Which of the following elements does NOT form a diatomic molecule?
    12·1 answer
  • How many grams of al are in 4.70 moles?
    7·1 answer
  • Oxidation-reduction is often the most confusing and abstract part of chemistry for first-time chemistry students. Is it really w
    7·1 answer
  • What is 99 dag converted cg
    14·1 answer
  • Why is energy required to break a chemical bond
    13·1 answer
  • 2. Which number is not a coefficient in the equation,
    5·2 answers
  • Did an oxidation-reduction reaction occur in the reaction between copper sulfate and sodium sulfide?
    14·2 answers
  • Does adding coefficients to a chemical equation disobey the law of definite proportions? Explain your answer.
    5·1 answer
  • Near Tatooine's famous Mos Eisley Space port you found a 520.79 mL block of gold. What is the mass in kilograms of this block?
    10·1 answer
  • The 4f subshell of an atom contains 14 electrons. What is the maximum number
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!