1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol13
2 years ago
15

The volume occupied by a gas at STP is 250 L. At what pressure (in atm) will the gas occupy 1500 L, if the temperature is consta

nt
Chemistry
1 answer:
Dennis_Churaev [7]2 years ago
8 0

Answer:

6 atm

Explanation:

Using the formula P1V1=P2V2

P1= Initial Pressure

V1= Initial Volume

P2= Final Pressure

V2= Final Volume

And knowing that at stp gas will always be at 1 atm

250L(P2) = 1500

P2= 6 atm

You might be interested in
Will give brainliest, like, 5 stars and 5 points to best answer
Oliga [24]

evaporation systems allow for an endless source of water. you can grab cups of water straight from the sea or even a lake. the use of evaporation allows for you to drink water thats even healthier than getting it from a cloud and it will leave all of the bad parts that used to be in the water in the first container you pour into. this system is most useful in hot climates such as places near the equator.  

6 0
3 years ago
PLEASEEEEEEEE ASAPPPPPWhat is the density of a piece of cardboard that has a mass of 250 g and volume of 46 mL? *
trapecia [35]
HEELP ME HELP ME HELP ME HELP ME HELP ME
6 0
3 years ago
Read 2 more answers
1. Which of the following best describes the relationship
Ipatiy [6.2K]
D there is one kind of cell of which all living things are made
8 0
3 years ago
Should we only write condensed formula in chemical equations (for lessons like carbon and compounds). What did your teachers say
Firlakuza [10]

Answer:

Here's what I get.

Explanation:

  • If your teachers don't ask for a specific type of formula, a condensed structural formula should be OK.
  • If they ask specifically for a structural formula or a bond-line formula, that is what you must give.

Bottom line: ask your teachers in advance what they expect.

7 0
3 years ago
What is the chemical reaction in the equation NaCl (s) → Na + (aq) + Cl - (aq)
kondor19780726 [428]

Answer:

exothermic reaction

when compounds dissolve they produce heat hence a chemical reaction that produces heat is known as endothermic reaction.

6 0
3 years ago
Other questions:
  • What is the empirical formula for Hg2(NO3)2
    13·1 answer
  • Convert: 950 g to kg
    7·1 answer
  • What is the pH of 0.0050 HF (Ka = 6.8 x 10-4)? <br> 2.73 <br> 11.70 <br> 11.27 <br> 2.30
    15·1 answer
  • What describes the current model of the atom? A)That electrons and protons move randomly around a nucleus.
    8·1 answer
  • Write each element and elements of atoms of the compound Na2PO3F
    10·1 answer
  • Perfume evaporating is it a chemical change or physical change
    10·2 answers
  • How molecules react to an increase in temperature.
    9·1 answer
  • Me and my sister needs help on this question PLEASE HELP! (Look at photo)
    6·2 answers
  • Will an atom gain or lose an electron? CER
    11·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!