1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
harina [27]
2 years ago
11

I Need Help on these science questions

Chemistry
2 answers:
gtnhenbr [62]2 years ago
5 0

Answer:

Page 1:  Embryonic stem cells | Page 2: I don't know | Page 3: Amoeba. Amoeba is a unicellular organism that has the ability to alter its shape. (I believe)

Explanation:

aalyn [17]2 years ago
4 0
Page 1:A,composed of one cell
Page 2:A,A and B
Page 3:cells reproduce through photosynthesis
You might be interested in
NaCl and AgNO3 react in a double replacement reaction. Which is one of the products of this reaction?
hoa [83]

Answer:

nano3+agcl2

Explanation:

double displacement reaction

7 0
2 years ago
An aircraft cannot reach flying speed on a short runway. Someone suggests reducing its cargo load. Which of Newton's laws is bei
ELEN [110]

Answer:

Second Law

Explanation:

Newton's second law states that the acceleration caused in a body is directly proportional to the force applied and inversely proportion to the mass of the body.

This is given by :

Acceleration=\frac{Force}{Mass}

In this case the suggestion given to reduce the aircraft's cargo load is the right move as reducing the load on the aircraft will decrease the mass of the whole aircraft.  This in turn will help the aircraft to accelerate more as acceleration inversely varies with mass. Thus the aircraft will be able to reach its flying speed even on a short run way.

Hence, Newton's second law is applied.

6 0
4 years ago
If the pressure of a gas sample is quadrupled and the absolute temperature is doubled, by what factor does the volume of the sam
Natasha_Volkova [10]

Answer:

D) 1/2

Explanation:

Using Ideal gas equation for same mole of gas as

\frac {{P_1}\times {V_1}}{T_1}=\frac {{P_2}\times {V_2}}{T_2}

Given,

P₂ = 4P₁

T₂ = 2T₁

Using above equation as:

\frac {{P_1}\times {V_1}}{T_1}=\frac {{P_2}\times {V_2}}{T_2}

\frac {{P_1}\times {V_1}}{T_1}=\frac {{4\times P_1}\times {V_2}}{2\times T_1}

V_2=\frac{1}{2}\times V_1

<u>The volume change by half of the original.</u>

7 0
3 years ago
Read 2 more answers
How many significant figures are in the measurement 0.03050
faltersainse [42]
There are 4 significant figures(3050)
8 0
3 years ago
Please answer these about Charles law
NNADVOKAT [17]

Answer:

1. V2.

2. 299K.

3. 451K

4. 0.25 x 451 = V2 x 299

Explanation:

1. The data obtained from the question include:

Initial volume (V1) = 0.25mL

Initial temperature (T1) = 26°C

Final temperature (T2) = 178°C

Final volume (V2) =.?

2. Conversion from celsius to Kelvin temperature.

T(K) = T (°C) + 273

Initial temperature (T1) = 26°C

Initial temperature (T1) = 26°C + 273 = 299K

3. Conversion from celsius to Kelvin temperature.

T(K) = T (°C) + 273

Final temperature (T2) = 178°C

Final temperature (T1) = 178°C + 273 = 451K

4. Initial volume (V1) = 0.25mL

Initial temperature (T1) = 299K

Final temperature (T2) = 451K

Final volume (V2) =.?

V1 x T2 = V2 x T1

0.25 x 451 = V2 x 299

6 0
3 years ago
Other questions:
  • What is a isotope ?
    15·2 answers
  • How many liters of water are required to dissolve 1.00 g of barium sulfate?
    8·1 answer
  • What would the carbon dioxide part of a soft drink be classified as?
    10·2 answers
  • What is <br><br> 114.1 kPa to atm
    8·1 answer
  • What element is salsa
    13·2 answers
  • What is 4.7 rounded to the nearest tenth
    12·2 answers
  • Air is compressed in a piston–cylinder device from 90 kPa and 20°C to 650 kPa in a reversible isothermal process. Determine the
    7·1 answer
  • give a general description of the location of metals , non metals and metalloids on the periodic table
    15·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • PLZ ANSWER FOR BRAINLIEST
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!