1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
postnew [5]
2 years ago
8

Select all the correct answers.

Chemistry
1 answer:
Andrei [34K]2 years ago
4 0

Scientists use scientific notation to communicate extremely small measurements. Hence, option A is correct.

<h3>What scientific notation?</h3>

Scientific notation is a way of writing very large or very small numbers.

Scientists use scientific notation to represent very small or very large numbers because this notation increases the  

  • accuracy of measured quantities.

  • convenience in using the numbers.

  • the number of significant figures.

  • precision of measurements.

Hence, option A is correct.

Learn more about the scientific notation here:

brainly.com/question/18073768

#SPJ1

You might be interested in
Coal and Diamond are two different form of carbon. which is denser?​
GalinKa [24]

Answer:

diamond is denser because it is more tightly packed than coal

7 0
3 years ago
Read 2 more answers
The elaboration likelihood model emphasizes the use of __________ persuasion and __________ persuasion methods. A. direct . . .
Angelina_Jolie [31]

Answer:

It's C, direct and peripheral.

Explanation:

Just took the test

6 0
3 years ago
Read 2 more answers
8. Sulfur has a first ionization energy of 1000 kJ/mol. Photons of what frequency are required to ionize one mole of Sulfur?​
Lynna [10]

Answer:

the frequency of photons v = 1.509\times10^{39}Hz

Explanation:

Given:  first ionization energy of 1000 kJ/mol.

No. of moles of sulfur = 1 mole

\Delta E_1 = 1000KJ/mol

We know that plank's constant

h = 6.626\times10^{-34} Js

Let the frequency of photons be ν

Also we know that ΔE = hν

this implies ν = ΔE/h

= \frac{10^6J}{6.626\times10^{-34} Js}

v = 1.509\times10^{39}Hz

Hence, the frequency of photons v = 1.509\times10^{39}Hz

6 0
3 years ago
There are four branched isomers of hexane. draw bond-line structures of all four of its isomers.
Finger [1]
C-c-c-c-c
   |
   c

c-c-c-c-c
      |
      c


    c
    |
c-c-c-c
    |
    c



c-c-c-c
   |   |
   c   c




3 0
3 years ago
What are the three sub-types of convergent plate boundaries
Vadim26 [7]
<span>Oceanic-oceanic convergent plate boundary. 2 Continental convergent plate boundary. 3 Oceanic-continental convergent plate boundary.</span>
3 0
4 years ago
Other questions:
  • a cylinder has a density of 3.75g/cm3. if it has a mass of 12.1 g and a diameter of 8.22 cm, what is its height?
    15·1 answer
  • Which of these describes a wave being reflected?
    9·1 answer
  • A solution of naoh(aq) contains 8.1 g of naoh(s) per 100.0 ml of solution. calculate the ph and the poh of the solution at 25 °c
    11·1 answer
  • What would happen if the cell cycle stopped in a multicellular organism
    13·1 answer
  • Chemical decontamination can be accomplished with liquids such as chlorox, Lysol, amphyl or a gas such as ethylene oxide.
    15·1 answer
  • What is Loschmidt’s number? How is it related to Avogadro’s number?
    15·1 answer
  • Calculate the number of moles of sulfuric acid in 0.49 g of sulfuric acid, H2SO4
    6·1 answer
  • Both formic acid and carbonic acid contain two hydrogen atoms. Why is the chemical formula of formic acid written HCHO₂ (with th
    5·1 answer
  • How many grams of product might form for the following reaction if 33.8 L of Oxygen gas is used in the following reaction? LiCl
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!