1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AlexFokin [52]
1 year ago
12

Can anyone help me in doing this question?

Chemistry
1 answer:
Alecsey [184]1 year ago
5 0

1. No. 108 g of Ag has a lower number of atoms than 80 g of Ca.

2. The gram of SO_3 in 3 moles of the compound would be 240 g.

3. 1.20 x 10^{24 atoms

4. The grams of hydrogen in 3.6 x 10^{24 molecules of NH_3 would be 18 grams.

<h3>Number of atoms in compounds</h3>

According to Avogadro, 1 mole of a substance contains 6.022 x 10^{23 molecules or atoms.

Recall that: mole = mass/molar mass

1. 108 g of Ag would be equivalent to: 108/108 = 1 mol.

80 g of Ca would be equivalent to: 80/40 = 2 mol

Since 1 mol is equivalent to 6.022 x 10^{23 molecules or atoms, it means 80 g of Ca has twice as atoms as 108 g of Ag.

2. 3 mol sample of SO_3 would be equivalent to: 3 x 80 = 240 g

3. 124 g of Na_2O would be equivalent to: 124/62 = 2 mol

Number of atoms = 2 x 6.022 x 10^{23

                              = 1.20 x 10^{24 atoms

4. 3.6 x 10^{24 molecules of NH_3 would be equivalent to:

  3.6 x 10^{24/6.022 x 10^{23 = 6 mol of NH_3

NH_3 --- > 3H^+ + N^{3-

From the above equation, 1 mole of NH_3 produces 3 moles of hydrogen.  Thus,  6 moles of  NH_3 would be equivalent to 18 moles of hydrogen.

18 moles of hydrogen = 18 x 1

                                    = 18 g

More on the number of atoms in samples can be found here: brainly.com/question/28834341

#SPJ1

You might be interested in
Oxygen decays to form nitrogen.
tatyana61 [14]

Answer:

Radioactive isotopes ranging from 11O to 26O have also been characterized, all short-lived. The longest-lived radioisotope is 15O with a half-life of 122.24 seconds, while the shortest-lived isotope is 12O with a half-life of 580(30)×10−24 seconds (the half-life of the unbound 11O is still unknown).

7 0
3 years ago
A helium balloon with an internal pressure of 1atm and a volume of 4.20 L at 18.0°C is released. What volume will the balloon oc
kari74 [83]

Answer:

7.59 L

Explanation:

- Use combined gas law formula and rearrange.

- Change C to K

- Hope that helped! Please let me know if you need further explanation.

3 0
3 years ago
What type of bond does hydrogen and carbon form
laila [671]
Covalent bond , hopefully this help :) explanation : .....
7 0
3 years ago
Read 2 more answers
Ch4+202==&gt;c02+302 what type of chemical reaction
n200080 [17]

Answer:

First of all, the equation is typed wrong so it can easily be misinterpreted

Ethane (CH4) + Oxygen gas (O2) would give us Carbon Dioxide (CO2) and WATER (H2O)

CH4 + 2O2 -----> CO2 + 2H2O

And this is a combustion reaction since we have oxygen as a reactant and carbon dioxide and water as products.

4 0
3 years ago
НСО,<br> 11. ___ Nacio,<br> &gt; --<br> _NaCl +
Ulleksa [173]

hydrochloric Acid Carbondale

4 0
3 years ago
Other questions:
  • What is the frequency of a wave?
    15·1 answer
  • What is the molar concentration of Na⁺(aq) in a solution that is prepared by mixing 10 mL of a 0.010 M NaHCO₃(aq) solution with
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • An electron moved from shell n = 2 to shell n = 1. What most likely happened during the transition?
    13·2 answers
  • Which type of muscle tissue is pictured?<br><br> cardiac<br> skeletal<br> smooth<br> striated
    6·1 answer
  • When a non metal gains or shares by two electrons,its valency will be​
    6·2 answers
  • How are the geographical equator, meteorological equator, and ITCZ related? What happens at the ITCZ?
    7·1 answer
  • Explain, in terms of ions, why the ability to conduct an electric current is greater for the
    11·1 answer
  • Which characteristics show that large herbivores are adapted to the taiga?
    8·2 answers
  • 32. Why do you think the Cl-ion is larger than a neutral Cl atom?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!