1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denpristay [2]
1 year ago
15

Choose the chemical equation that is correctly balanced. 2ca(s) cl2(g) → cacl2(s) 4mg(s) o2(g) → 2mgo(s) li(s) cl2(g) → 2licl(s)

c(s) o2(g) → co2(g)
Chemistry
1 answer:
Nadusha1986 [10]1 year ago
8 0
The final one because there is 1 C on each side and 2 O
You might be interested in
What is the joining of atoms to form new substances called?
kirill115 [55]
Chemical bonds is the answer
3 0
3 years ago
Why do you have to have a certain number of reactants on one side?
Debora [2.8K]

Answer:

EWQEQW

Explanation:

WEQWE

3 0
2 years ago
Determine whether or not each ion contributes to water hardness.
Virty [35]

Answer: The ion that contribute to water hardness are:

--> a. Ca2+

--> b. (HCO)3^- and

--> c. Mg2+

While K+ DOES NOT contribute to water hardness.

Explanation:

WATER in chemistry is known as a universal solvent. This is so because it is polar in nature and dissolves most inorganic solutes and some polar organic solutes to form aqueous solutions. It is composed of elements such as hydrogen and oxygen in the combined ratio of 2:1.

Water is said to be HARD if it does not lather readily with soap. There are two types of water hardness:

--> Permanent hardness: This is mainly due to the presence of CALCIUM and MAGNESIUM ions in the form of soluble tetraoxosulphate(VI) and chlorides. These ions are removed by adding washing soda or caustic soda.

--> Temporary hardness: This is due to the presence of calcium HYDROGENTRIOXOCARBONATES. It can be removed by boiling and using slaked lime.

Therefore from the above given ions, Ca2+,(HCO)3^- and Mg2+ contributes to water hardness.

4 0
2 years ago
hEEEYYYY peeps! this is the same related question about another scientist with the cells, so yeaaaaaah...btw meh teacher also ma
ki77a [65]

Answer:

im pretty sure it is D

Explanation:

this is an old term for a microscopic organisms that included bacteria, protozoans, and very small animals

4 0
2 years ago
A student practicing for a track meet ran 300 meters in 30 seconds. what was her average speed?​
ololo11 [35]

Answer:

<h2>10 m/s</h2>

Explanation:

Her average speed can be found by using the formula

v =  \frac{d}{t}  \\

d is the distance

t is the time taken

From the question we have

v =  \frac{300}{30}  = 10 \\

We have the final answer as

<h3>10 m/s</h3>

Hope this helps you

7 0
3 years ago
Other questions:
  • Plz help me and I promise I will make you he brainiest
    8·1 answer
  • Explain why gasoline will not dissolve in water.
    12·2 answers
  • What element has beryl emeralds and aquamarine?
    10·1 answer
  • An amide may be produced by reacting an acid chloride with
    15·2 answers
  • Which shows the formula for an organic acid?
    5·1 answer
  • Make a drawing of the particles in an NaCl solution to show why this solution conducts electricity. Make a drawing of the partic
    7·1 answer
  • 2 3 4 5 6 7 8 9 10
    8·1 answer
  • A high energy state is not ideal for atoms, as a result, they form bonds with other atoms. In doing so, what happens to the ener
    8·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • According to the theory of plate tectonics,
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!