1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stepan [7]
1 year ago
5

What is the molarity of a solution prepared by dissolving 36. 0 g of naoh in enough water to make 1. 50 l of solution?

Chemistry
1 answer:
Vlada [557]1 year ago
4 0

0.6 mol / L is the molarity of a solution prepared by dissolving 36. 0 g of NaOH in enough water to make 1. 50 l of solution.

The amount of a substance in a specific volume of solution is known as its molarity (M). The number of moles of a solute per liter of a solution is known as molarity. The molar concentration of a solution is another term for molarity.

The ratio employed to indicate the solution's concentration is called its molarity. Understanding a solution's molarity is important since it allows you to determine the actual concentration as well as whether the solution is diluted or concentrated.

Amount of NaOH = 36. 0 g

Amount of water = 1. 50 L

1 mol of NaOH = 40 g,

Moles of NaOH = 36. 0 / 40 g = 0.9 mol NaOH

Molarity of a solution = moles of solute / Liters of solution

Molarity of a solution = 0.9 / 1.50

Molarity of a solution = 0.6 mol / L

To  know more about Molarity refer to:  brainly.com/question/8732513

#SPJ4

You might be interested in
For the following formula, C4H9Cl, calculate the IHD and select all the types of unsaturation that might be present in the molec
Airida [17]

Answer:

The IHD = 0

There is no unsaturation in the compound C4H9Cl

Explanation:

IHD = Index for Hydrogen Deficiency .It determines total number of unsaturation or Pi- bond present in the molecule.It is calculated using the formula:

For Molecule:

C_{c}H_{h}O_{o}N_{n}X_{x}

Here . C = carbon

H = Hydrogen

O = Oxygen

N = Nitrogen

X = Halogen

The IHD is calculated as :

\frac{2c-h-x+n+2}{2}...............(1)

For example :

C4H8O2

Here c = 4 , h = 8 , o = 2 .

n = x=0

Put the value in equation (1) and find IHD

\frac{2(4)-8-0+0+2}{2}

\frac{8-8+2}{2}

\frac{2}{2}

IHD = 1

For C4H9Cl

c = 4 , h = 9 and  x = 1

IHD for this molecule can be calculated as :

\frac{2c-h-x+n+2}{2}

\frac{2(4)-9-1+2}{2}

\frac{8-9-1+2}{2}

= 0

This means there is no unsaturation in the molecule.

Each bond is sigma bond and properly saturated.

5 0
3 years ago
Explain the difference between heat and temperature. Does 1 L of water at 658°F have more, less, or the same quantity of energy
pogonyaev

The answer is- The energy of 1 L water at temperature 347.78 °C have more energy as 1 L of water at temperature 65°C.

Heat is a type of energy that causes a person's body to feel hot or cold.

While the temperature of an object is a parameter that indicates how hot or cold the object is.

How is the temperature in degree Fahrenheit converted to degree celsius?

  • To convert the temperature in Fahrenheit to Celsius, subtract 32 and multiply by 5/9.

°C =( ^0F -32) * \frac{5}{9}

  • Now, heat is a form of energy that flows from hotter object to colder object and temperature indicates whether the object is hot or cold by measuring its average kinetic energy.
  • Now, the given temperature of 1 L water is 658 °F. This temperature in degree celsius is calculated as-

°C = (658 F-32) *\frac{5}{9} = 347.78 \° C

  • Now, higher the temperature, higher is the energy of water. Thus, the energy of 1 L water at 347.78 °C have more energy as 1 L of water at 65°C.

To learn more about heat and temperature, visit:

brainly.com/question/20038450

#SPJ4

3 0
2 years ago
a glass of ice at 0 degrees Celsius changes to a glass of water at 0 degrees Celsius what caused the ice to change to water
Tanya [424]
Thermal energy was absorbed.
6 0
3 years ago
What do all nickel atoms have in common
Mama L [17]
All nickel atoms would have the same number of protons or atomic number.
4 0
3 years ago
A gas has a volume of 340.0 mL at 45.90 oC. What is the new temperature of the gas, in Kelvin, if the volume increased to 550.0
d1i1m1o1n [39]

Answer:

Solution for A gas has a volume of 340.0 mL at 45.90 degree celsius. What is the new temperature of the gas, in kelvin, if the volume increased to 550.0 mL.

Missing: oC. ‎| Must include: oC.

Explanation:

6 0
3 years ago
Other questions:
  • How many grams of chlorine must be added to a balloon containing 8.00 grams of helium to double its volume?
    14·1 answer
  • The iupac name for a carboxylic acid with two carbons in a straight chain would be _____.
    12·1 answer
  • Hydrochloric acid has the chemical formula HCl. A certain quantity of hydrochloric acid has 2.39x1024 atoms. How many moles of h
    13·1 answer
  • What is the role a species can assume in an ecosystem?
    14·1 answer
  • The pH of a solution is measured as 8.3. What is the hydrogen ion concentration of the solution?
    9·1 answer
  • What are the chemical properties of neon?
    7·1 answer
  • An ionic compound has a generic formula of QR2.
    15·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Convert the following measurements into the indicated units:<br><br>​
    9·1 answer
  • A 50.0 g sample of liquid water at 0.0°c ends up as ice at -20.0°c. How much energy is involved in this change.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!