1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ray Of Light [21]
3 years ago
5

Near the shore ,winds tend to blow out toward the water at night.what drives this process

Chemistry
2 answers:
Marizza181 [45]3 years ago
7 0

Near the shore, winds seem to blow out towards the water at night as warm air above the water elevates and gets substituted by cooler air from the land causing the convection current.  

The convection currents conduct heat from one place to another by mass motion of a fluid like air, water, or molten rock. The heat transfer function of convection currents mediates the ocean currents of the Earth, geology, and atmospheric weather.  

Alisiya [41]3 years ago
6 0
Warm air from above the water rises and is replaced by the cool air from the shore
You might be interested in
Many people avoid processed food to eliminate unnecessary ingredients like food dyes and excess sodium from their diets. A study
kvv77 [185]
It should be the answer b but I’m not to sure
4 0
3 years ago
Which statement tells what happens during the rock cycle when rocks undergo great heat and pressure? A. Igneous rock is formed.
balu736 [363]
<span>B. Metamorphic rock is formed</span>
3 0
3 years ago
What promotes greater hardness in minerals?
Mashutka [201]

Smaller atoms and stronger bonds promotes greater hardness in minerals.

7 0
3 years ago
Read 2 more answers
In your OWN WORDS, describe what the “Law of Conservation of Energy” is.
agasfer [191]
Energy cannot be destroyed or created, but energy could be transformed or transferred. For example a skiier skiing from the mouth can have potential energy transferred into kinetic energy.
4 0
2 years ago
Which lewis structures represent a molecule that would assume a linear geometry? check all that apply.
Daniel [21]
CO2, C2H2, BeF2, XeF2, etc all these molecules have linear geometry.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which statements describe lattice energy?
    7·1 answer
  • Attempt 3 During an experiment, a student adds 2.90 g CaO 2.90 g CaO to 400.0 mL 400.0 mL of 1.500 M HCl 1.500 M HCl . The stude
    10·1 answer
  • Consider the following balanced reaction between hydrogen and nitrogen to form ammonia:
    14·1 answer
  • Is cutting grass of physical change or chemical change
    9·2 answers
  • What are chemical properties of ionic compounds
    15·1 answer
  • The satellite image above shows a portion of the Namib Desert in Africa. This is an ancient, sandy desert with dunes that can be
    6·1 answer
  • What do scientists who study the human microbiome hope to achieve?
    6·2 answers
  • What is the noble gas configuration of V+3
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • The dimensions of a box are 4.5 cm wide by 5.750 cm long by 1.50 cm tall. What is the volume of the box , taking significant fig
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!